Incidental Mutation 'R0718:Adrm1'
ID262030
Institutional Source Beutler Lab
Gene Symbol Adrm1
Ensembl Gene ENSMUSG00000039041
Gene Nameadhesion regulating molecule 1
Synonyms2510006J17Rik, Rpn13, 1110063P18Rik, Gp110, ARM-1
MMRRC Submission 038900-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.662) question?
Stock #R0718 (G1)
Quality Score41
Status Validated
Chromosome2
Chromosomal Location180171485-180176286 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 180175147 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000050076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015791] [ENSMUST00000061437]
PDB Structure
Crystal structure of the proteasomal Rpn13 PRU-domain [X-RAY DIFFRACTION]
Complex Structures of Mouse Rpn13 (22-130aa) and ubiquitin [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000015791
SMART Domains Protein: ENSMUSP00000015791
Gene: ENSMUSG00000015647

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
LamNT 44 303 1.06e-132 SMART
EGF_Lam 305 361 4.35e-6 SMART
EGF_Lam 364 431 5.78e-11 SMART
EGF_Lam 434 476 1.32e-5 SMART
EGF_Lam 500 544 8.63e-10 SMART
EGF_Lam 547 590 1.16e-10 SMART
EGF_Lam 593 635 4.63e-10 SMART
EGF_Lam 638 680 6.25e-7 SMART
EGF_Lam 683 726 3.1e-11 SMART
EGF_Lam 730 779 2.99e-4 SMART
EGF_Lam 782 831 4.66e-6 SMART
EGF_Lam 834 878 3.48e-5 SMART
low complexity region 1261 1273 N/A INTRINSIC
EGF_Lam 1443 1486 7.01e-10 SMART
EGF_like 1489 1530 3.64e-1 SMART
EGF_Lam 1533 1579 8.56e-14 SMART
EGF_Lam 1582 1630 1.86e-14 SMART
LamB 1689 1819 5.86e-61 SMART
EGF_like 1818 1862 2.74e0 SMART
EGF_Lam 1865 1912 3.32e-11 SMART
EGF_Lam 1915 1968 1.61e-9 SMART
EGF_Lam 1971 2022 6.39e-13 SMART
EGF_Lam 2025 2069 1.94e-12 SMART
EGF_Lam 2072 2116 1.35e-11 SMART
EGF_like 2103 2145 3.1e1 SMART
EGF_Lam 2119 2166 1.18e-2 SMART
Pfam:Laminin_I 2189 2453 1.7e-65 PFAM
low complexity region 2532 2548 N/A INTRINSIC
low complexity region 2557 2569 N/A INTRINSIC
low complexity region 2632 2641 N/A INTRINSIC
low complexity region 2663 2676 N/A INTRINSIC
LamG 2760 2912 3.97e-8 SMART
LamG 2966 3103 1.78e-10 SMART
LamG 3149 3274 1.11e-20 SMART
LamG 3359 3497 4.05e-23 SMART
LamG 3539 3670 3e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061437
SMART Domains Protein: ENSMUSP00000050076
Gene: ENSMUSG00000039041

DomainStartEndE-ValueType
Pfam:Proteasom_Rpn13 29 111 3.5e-35 PFAM
low complexity region 135 161 N/A INTRINSIC
low complexity region 173 254 N/A INTRINSIC
Pfam:RPN13_C 268 381 7.3e-38 PFAM
low complexity region 390 403 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185089
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adhesion regulating molecule 1 protein family. The encoded protein is a component of the proteasome where it acts as a ubiquitin receptor and recruits the deubiquitinating enzyme, ubiquitin carboxyl-terminal hydrolase L5. Increased levels of the encoded protein are associated with increased cell adhesion, which is likely an indirect effect of this intracellular protein. Dysregulation of this gene has been implicated in carcinogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased birth weight, reduced competition for food, postnatal lethality, infertility, impaired sperm and oocyte development, increased peripheral CD4+ and CD8+ T cells, and increased serum GH and FSH levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 A T 3: 95,679,608 Y811N possibly damaging Het
Alms1 T A 6: 85,621,821 S1210T probably benign Het
Ampd3 C T 7: 110,777,808 P11L probably damaging Het
Arhgap5 A G 12: 52,516,507 E87G possibly damaging Het
Armc5 C T 7: 128,240,070 probably benign Het
Asic2 C G 11: 80,971,456 probably benign Het
Asph A G 4: 9,514,683 probably benign Het
Bicd2 T A 13: 49,377,875 probably null Het
Brip1 A G 11: 86,143,305 L530P possibly damaging Het
Bsn G T 9: 108,111,360 probably benign Het
Btnl4 T A 17: 34,469,634 H390L probably benign Het
Ccdc70 A C 8: 21,973,308 K38T probably damaging Het
Ccni G A 5: 93,202,316 P35S probably benign Het
Cdh17 A G 4: 11,810,451 D714G possibly damaging Het
Cenpf A G 1: 189,653,984 L2033P probably damaging Het
Cfap69 A T 5: 5,621,924 M328K probably damaging Het
Cmah T G 13: 24,417,210 probably null Het
Cog6 T C 3: 53,010,629 T163A probably benign Het
Cyp2j8 G A 4: 96,501,196 S130F probably benign Het
Dgki A G 6: 37,012,896 V636A probably damaging Het
Dmkn T A 7: 30,764,786 probably benign Het
Dnah6 A G 6: 73,035,293 I3679T possibly damaging Het
Dsp A T 13: 38,196,764 Y2495F possibly damaging Het
Exosc4 C T 15: 76,329,489 A171V probably benign Het
Fbxw24 A G 9: 109,623,509 probably benign Het
Flvcr1 A T 1: 191,025,582 L171Q probably damaging Het
Fsd1 G T 17: 55,996,445 probably null Het
Gm7732 A G 17: 21,129,844 noncoding transcript Het
H2-K2 A C 17: 33,975,623 noncoding transcript Het
Hgf A G 5: 16,593,859 N295S probably damaging Het
Ift88 T A 14: 57,517,413 D811E probably benign Het
Igsf9b T A 9: 27,323,361 probably null Het
Immt T A 6: 71,863,172 V311E probably damaging Het
Ipo11 T A 13: 106,919,611 N51I possibly damaging Het
Isy1 T C 6: 87,819,176 K260E probably damaging Het
Jchain T G 5: 88,526,202 I28L probably benign Het
Jmjd1c T A 10: 67,218,946 probably null Het
Kif13b T C 14: 64,751,662 probably benign Het
Klhdc7b T C 15: 89,388,169 Y427H possibly damaging Het
Klhl8 T C 5: 103,876,293 probably benign Het
Lrp2 C T 2: 69,510,948 D963N probably damaging Het
Ltbp3 G T 19: 5,746,748 probably benign Het
Ltf C A 9: 111,040,379 Q41K probably benign Het
Med4 T A 14: 73,516,657 I148N probably damaging Het
Mlh3 T G 12: 85,247,697 S1242R possibly damaging Het
Mllt6 T C 11: 97,676,359 probably benign Het
Mpdz A G 4: 81,292,473 I1712T possibly damaging Het
Mrgprb4 T A 7: 48,198,553 H209L probably benign Het
Nkapl A T 13: 21,468,440 M1K probably null Het
Nmur2 T A 11: 56,029,498 probably benign Het
Nsun2 T A 13: 69,543,697 probably benign Het
Olfr1082 G A 2: 86,594,081 T249I probably benign Het
Olfr1130 A G 2: 87,607,927 I180V probably benign Het
Ovgp1 T C 3: 105,974,830 probably benign Het
Pcdh8 A G 14: 79,770,691 V144A possibly damaging Het
Pcnx3 G A 19: 5,677,728 probably benign Het
Pla2r1 C A 2: 60,479,530 V570L possibly damaging Het
Plxnd1 C A 6: 115,966,638 E1202D possibly damaging Het
Ppp1r37 T C 7: 19,532,254 E529G probably benign Het
Prdm15 A G 16: 97,812,633 F496L possibly damaging Het
Prlhr A T 19: 60,468,005 V41D probably benign Het
Prlhr G T 19: 60,468,059 S23* probably null Het
Prpf4 C T 4: 62,414,540 probably benign Het
Psg26 C T 7: 18,475,235 R416H probably benign Het
Psg26 T C 7: 18,478,287 H381R probably benign Het
Ralgds T G 2: 28,549,116 M717R probably benign Het
Rbms1 T C 2: 60,842,412 N44D probably damaging Het
Rpa1 T C 11: 75,318,401 probably benign Het
Rprd2 T C 3: 95,766,387 N568S probably benign Het
Rptor A G 11: 119,872,376 M929V probably benign Het
Rspo1 T A 4: 125,007,149 C97S possibly damaging Het
Scin C T 12: 40,079,607 G396S probably damaging Het
Scn9a T C 2: 66,547,112 N409D probably damaging Het
Sf3b1 A G 1: 55,019,385 I15T probably damaging Het
Sh3bp2 T C 5: 34,555,495 V149A probably damaging Het
Slc39a12 T A 2: 14,407,426 probably benign Het
Sp9 G T 2: 73,273,827 A242S possibly damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tatdn3 G T 1: 191,052,849 probably benign Het
Tex14 G A 11: 87,499,613 V379I probably benign Het
Tmed6 T C 8: 107,061,724 N197S probably damaging Het
Ttbk2 G A 2: 120,748,575 L689F probably benign Het
Ttbk2 A T 2: 120,745,160 I1043N probably benign Het
Ttn A G 2: 76,810,696 S5283P probably damaging Het
Ube3b C A 5: 114,402,555 S441* probably null Het
Ush2a G A 1: 188,797,830 C3272Y probably damaging Het
Vac14 T A 8: 110,632,477 I95K probably damaging Het
Vangl2 G A 1: 172,006,217 A433V probably damaging Het
Vwa5b1 A T 4: 138,608,824 V153D probably damaging Het
Zfhx3 T A 8: 108,955,650 D3240E unknown Het
Zfp945 A G 17: 22,851,030 C632R probably damaging Het
Zfyve26 G A 12: 79,265,802 probably benign Het
Zyg11b A T 4: 108,242,076 I606N possibly damaging Het
Other mutations in Adrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Adrm1 APN 2 180175963 splice site probably benign
IGL02938:Adrm1 APN 2 180175602 missense probably damaging 0.98
R1129:Adrm1 UTSW 2 180172919 unclassified probably benign
R2389:Adrm1 UTSW 2 180174323 unclassified probably benign
R2875:Adrm1 UTSW 2 180175618 missense probably damaging 0.96
R2876:Adrm1 UTSW 2 180175618 missense probably damaging 0.96
R3085:Adrm1 UTSW 2 180174301 unclassified probably null
R4086:Adrm1 UTSW 2 180172834 intron probably benign
R4608:Adrm1 UTSW 2 180174855 splice site probably benign
R5416:Adrm1 UTSW 2 180176137 missense probably benign 0.06
R5536:Adrm1 UTSW 2 180172188 unclassified probably benign
R5575:Adrm1 UTSW 2 180175716 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTGACATGAATACCAGGCACTAC -3'
(R):5'- GTTTATGGTCAGCAGTCCTTCACCC -3'

Sequencing Primer
(F):5'- TGAATACCAGGCACTACCTAGC -3'
(R):5'- CGGCACGTTCATAGTGGC -3'
Posted On2015-02-04