Incidental Mutation 'R0718:Armc5'
ID 262035
Institutional Source Beutler Lab
Gene Symbol Armc5
Ensembl Gene ENSMUSG00000042178
Gene Name armadillo repeat containing 5
Synonyms
MMRRC Submission 038900-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.801) question?
Stock # R0718 (G1)
Quality Score 40
Status Validated
Chromosome 7
Chromosomal Location 127836514-127844272 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) C to T at 127839242 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044660] [ENSMUST00000078816]
AlphaFold Q5EBP3
Predicted Effect probably benign
Transcript: ENSMUST00000044660
SMART Domains Protein: ENSMUSP00000040568
Gene: ENSMUSG00000042178

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 62 104 N/A INTRINSIC
ARM 137 179 2.89e-1 SMART
ARM 180 221 3.32e-1 SMART
ARM 222 263 2.93e-2 SMART
Blast:ARM 265 306 1e-8 BLAST
low complexity region 313 338 N/A INTRINSIC
ARM 353 399 4.88e0 SMART
low complexity region 418 431 N/A INTRINSIC
low complexity region 670 690 N/A INTRINSIC
Pfam:BTB 742 854 9.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078816
SMART Domains Protein: ENSMUSP00000077867
Gene: ENSMUSG00000062944

DomainStartEndE-ValueType
ZnF_C2H2 88 110 1.89e-1 SMART
ZnF_C2H2 116 138 7.49e-5 SMART
ZnF_C2H2 144 166 1.12e-3 SMART
ZnF_C2H2 172 194 2.4e-3 SMART
ZnF_C2H2 200 222 1.95e-3 SMART
ZnF_C2H2 228 250 3.89e-3 SMART
ZnF_C2H2 256 278 1.1e-2 SMART
ZnF_C2H2 284 306 1.33e-1 SMART
ZnF_C2H2 312 334 2.53e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206509
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ARM (armadillo/beta-catenin-like repeat) superfamily. The ARM repeat is a tandemly repeated sequence motif with approximately 40 amino acid long. This repeat is implicated in mediating protein-protein interactions. The encoded protein contains seven ARM repeats. Mutations in this gene are associated with primary bilateral macronodular adrenal hyperplasia, which is also known as ACTH-independent macronodular adrenal hyperplasia 2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality with defects in mesoderm formation and gastrulation. The few survbiving mice are smaller than normal. Mice heterozygous for the same allele exhibit abnormal adrenocortical morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 A T 3: 95,586,918 (GRCm39) Y811N possibly damaging Het
Adrm1 T C 2: 179,816,940 (GRCm39) probably benign Het
Alms1 T A 6: 85,598,803 (GRCm39) S1210T probably benign Het
Ampd3 C T 7: 110,377,015 (GRCm39) P11L probably damaging Het
Arhgap5 A G 12: 52,563,290 (GRCm39) E87G possibly damaging Het
Asic2 C G 11: 80,862,282 (GRCm39) probably benign Het
Asph A G 4: 9,514,683 (GRCm39) probably benign Het
Bicd2 T A 13: 49,531,351 (GRCm39) probably null Het
Brip1 A G 11: 86,034,131 (GRCm39) L530P possibly damaging Het
Bsn G T 9: 107,988,559 (GRCm39) probably benign Het
Btnl4 T A 17: 34,688,608 (GRCm39) H390L probably benign Het
Ccdc70 A C 8: 22,463,324 (GRCm39) K38T probably damaging Het
Ccni G A 5: 93,350,175 (GRCm39) P35S probably benign Het
Cdh17 A G 4: 11,810,451 (GRCm39) D714G possibly damaging Het
Cenpf A G 1: 189,386,181 (GRCm39) L2033P probably damaging Het
Cfap69 A T 5: 5,671,924 (GRCm39) M328K probably damaging Het
Cmah T G 13: 24,601,193 (GRCm39) probably null Het
Cog6 T C 3: 52,918,050 (GRCm39) T163A probably benign Het
Cyp2j8 G A 4: 96,389,433 (GRCm39) S130F probably benign Het
Dgki A G 6: 36,989,831 (GRCm39) V636A probably damaging Het
Dmkn T A 7: 30,464,211 (GRCm39) probably benign Het
Dnah6 A G 6: 73,012,276 (GRCm39) I3679T possibly damaging Het
Dsp A T 13: 38,380,740 (GRCm39) Y2495F possibly damaging Het
Exosc4 C T 15: 76,213,689 (GRCm39) A171V probably benign Het
Fbxw24 A G 9: 109,452,577 (GRCm39) probably benign Het
Flvcr1 A T 1: 190,757,779 (GRCm39) L171Q probably damaging Het
Fsd1 G T 17: 56,303,445 (GRCm39) probably null Het
Gm7732 A G 17: 21,350,106 (GRCm39) noncoding transcript Het
H2-K2 A C 17: 34,194,597 (GRCm39) noncoding transcript Het
Hgf A G 5: 16,798,857 (GRCm39) N295S probably damaging Het
Ift88 T A 14: 57,754,870 (GRCm39) D811E probably benign Het
Igsf9b T A 9: 27,234,657 (GRCm39) probably null Het
Immt T A 6: 71,840,156 (GRCm39) V311E probably damaging Het
Ipo11 T A 13: 107,056,119 (GRCm39) N51I possibly damaging Het
Isy1 T C 6: 87,796,158 (GRCm39) K260E probably damaging Het
Jchain T G 5: 88,674,061 (GRCm39) I28L probably benign Het
Jmjd1c T A 10: 67,054,725 (GRCm39) probably null Het
Kif13b T C 14: 64,989,111 (GRCm39) probably benign Het
Klhdc7b T C 15: 89,272,372 (GRCm39) Y427H possibly damaging Het
Klhl8 T C 5: 104,024,159 (GRCm39) probably benign Het
Lrp2 C T 2: 69,341,292 (GRCm39) D963N probably damaging Het
Ltbp3 G T 19: 5,796,776 (GRCm39) probably benign Het
Ltf C A 9: 110,869,447 (GRCm39) Q41K probably benign Het
Med4 T A 14: 73,754,097 (GRCm39) I148N probably damaging Het
Mlh3 T G 12: 85,294,471 (GRCm39) S1242R possibly damaging Het
Mllt6 T C 11: 97,567,185 (GRCm39) probably benign Het
Mpdz A G 4: 81,210,710 (GRCm39) I1712T possibly damaging Het
Mrgprb4 T A 7: 47,848,301 (GRCm39) H209L probably benign Het
Nkapl A T 13: 21,652,610 (GRCm39) M1K probably null Het
Nmur2 T A 11: 55,920,324 (GRCm39) probably benign Het
Nsun2 T A 13: 69,691,816 (GRCm39) probably benign Het
Or10ag60 A G 2: 87,438,271 (GRCm39) I180V probably benign Het
Or8k35 G A 2: 86,424,425 (GRCm39) T249I probably benign Het
Ovgp1 T C 3: 105,882,146 (GRCm39) probably benign Het
Pcdh8 A G 14: 80,008,131 (GRCm39) V144A possibly damaging Het
Pcnx3 G A 19: 5,727,756 (GRCm39) probably benign Het
Pla2r1 C A 2: 60,309,874 (GRCm39) V570L possibly damaging Het
Plxnd1 C A 6: 115,943,599 (GRCm39) E1202D possibly damaging Het
Ppp1r37 T C 7: 19,266,179 (GRCm39) E529G probably benign Het
Prdm15 A G 16: 97,613,833 (GRCm39) F496L possibly damaging Het
Prlhr G T 19: 60,456,497 (GRCm39) S23* probably null Het
Prlhr A T 19: 60,456,443 (GRCm39) V41D probably benign Het
Prpf4 C T 4: 62,332,777 (GRCm39) probably benign Het
Psg26 C T 7: 18,209,160 (GRCm39) R416H probably benign Het
Psg26 T C 7: 18,212,212 (GRCm39) H381R probably benign Het
Ralgds T G 2: 28,439,128 (GRCm39) M717R probably benign Het
Rbms1 T C 2: 60,672,756 (GRCm39) N44D probably damaging Het
Rpa1 T C 11: 75,209,227 (GRCm39) probably benign Het
Rprd2 T C 3: 95,673,699 (GRCm39) N568S probably benign Het
Rptor A G 11: 119,763,202 (GRCm39) M929V probably benign Het
Rspo1 T A 4: 124,900,942 (GRCm39) C97S possibly damaging Het
Scin C T 12: 40,129,606 (GRCm39) G396S probably damaging Het
Scn9a T C 2: 66,377,456 (GRCm39) N409D probably damaging Het
Sf3b1 A G 1: 55,058,544 (GRCm39) I15T probably damaging Het
Sh3bp2 T C 5: 34,712,839 (GRCm39) V149A probably damaging Het
Slc39a12 T A 2: 14,412,237 (GRCm39) probably benign Het
Sp9 G T 2: 73,104,171 (GRCm39) A242S possibly damaging Het
Srr A G 11: 74,801,891 (GRCm39) V126A possibly damaging Het
Tatdn3 G T 1: 190,785,046 (GRCm39) probably benign Het
Tex14 G A 11: 87,390,439 (GRCm39) V379I probably benign Het
Tmed6 T C 8: 107,788,356 (GRCm39) N197S probably damaging Het
Ttbk2 A T 2: 120,575,641 (GRCm39) I1043N probably benign Het
Ttbk2 G A 2: 120,579,056 (GRCm39) L689F probably benign Het
Ttn A G 2: 76,641,040 (GRCm39) S5283P probably damaging Het
Ube3b C A 5: 114,540,616 (GRCm39) S441* probably null Het
Ush2a G A 1: 188,530,027 (GRCm39) C3272Y probably damaging Het
Vac14 T A 8: 111,359,109 (GRCm39) I95K probably damaging Het
Vangl2 G A 1: 171,833,784 (GRCm39) A433V probably damaging Het
Vwa5b1 A T 4: 138,336,135 (GRCm39) V153D probably damaging Het
Zfhx3 T A 8: 109,682,282 (GRCm39) D3240E unknown Het
Zfp945 A G 17: 23,070,004 (GRCm39) C632R probably damaging Het
Zfyve26 G A 12: 79,312,576 (GRCm39) probably benign Het
Zyg11b A T 4: 108,099,273 (GRCm39) I606N possibly damaging Het
Other mutations in Armc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Armc5 APN 7 127,843,255 (GRCm39) missense probably benign 0.00
R0538:Armc5 UTSW 7 127,843,463 (GRCm39) missense probably damaging 1.00
R0920:Armc5 UTSW 7 127,839,491 (GRCm39) missense probably damaging 1.00
R1922:Armc5 UTSW 7 127,839,677 (GRCm39) missense probably benign
R2943:Armc5 UTSW 7 127,839,752 (GRCm39) missense probably damaging 1.00
R4663:Armc5 UTSW 7 127,837,717 (GRCm39) missense probably benign 0.14
R4679:Armc5 UTSW 7 127,839,276 (GRCm39) missense possibly damaging 0.95
R4910:Armc5 UTSW 7 127,839,900 (GRCm39) missense possibly damaging 0.67
R5466:Armc5 UTSW 7 127,839,336 (GRCm39) missense probably damaging 0.99
R5954:Armc5 UTSW 7 127,841,444 (GRCm39) missense probably benign 0.18
R6912:Armc5 UTSW 7 127,839,597 (GRCm39) missense probably damaging 1.00
R6940:Armc5 UTSW 7 127,839,470 (GRCm39) nonsense probably null
R8410:Armc5 UTSW 7 127,839,323 (GRCm39) missense probably damaging 1.00
R8768:Armc5 UTSW 7 127,841,783 (GRCm39) missense probably benign 0.07
R8783:Armc5 UTSW 7 127,837,425 (GRCm39) missense probably damaging 0.96
Z1177:Armc5 UTSW 7 127,843,835 (GRCm39) missense probably damaging 1.00
Z1177:Armc5 UTSW 7 127,840,002 (GRCm39) missense probably damaging 0.98
Z1177:Armc5 UTSW 7 127,839,797 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAAGACAGACAGCATCCAGAAC -3'
(R):5'- TTTAGGGTGAGAAGCCAGGCTGAC -3'

Sequencing Primer
(F):5'- TCCAGAACCGGACAGCG -3'
(R):5'- ACTTAGCTGCTCAGCACAGG -3'
Posted On 2015-02-04