Incidental Mutation 'R0718:Dsp'
ID262041
Institutional Source Beutler Lab
Gene Symbol Dsp
Ensembl Gene ENSMUSG00000054889
Gene Namedesmoplakin
Synonyms5730453H04Rik, DP, 2300002E22Rik
MMRRC Submission 038900-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0718 (G1)
Quality Score38
Status Validated
Chromosome13
Chromosomal Location38151294-38198577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38196764 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 2495 (Y2495F)
Ref Sequence ENSEMBL: ENSMUSP00000115062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]
Predicted Effect possibly damaging
Transcript: ENSMUST00000124830
AA Change: Y2495F

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: Y2495F

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-96 BLAST
Blast:SPEC 783 894 4e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1370 N/A INTRINSIC
coiled coil region 1394 1956 N/A INTRINSIC
low complexity region 1997 2011 N/A INTRINSIC
PLEC 2021 2057 3.33e-1 SMART
PLEC 2058 2095 3.76e-9 SMART
PLEC 2096 2133 4.09e-10 SMART
PLEC 2134 2171 2.09e-7 SMART
PLEC 2175 2209 4.83e1 SMART
PLEC 2210 2245 5.67e1 SMART
PLEC 2263 2300 1.22e-8 SMART
PLEC 2301 2338 1.16e-9 SMART
PLEC 2339 2376 1.12e-7 SMART
PLEC 2377 2414 1.56e-6 SMART
PLEC 2418 2452 1.42e0 SMART
PLEC 2468 2505 3.7e-8 SMART
low complexity region 2507 2517 N/A INTRINSIC
PLEC 2519 2556 3.73e-4 SMART
low complexity region 2577 2593 N/A INTRINSIC
PLEC 2622 2659 1.46e-6 SMART
PLEC 2660 2697 6.69e-15 SMART
PLEC 2698 2735 1.98e2 SMART
PLEC 2736 2773 2.35e-10 SMART
PLEC 2774 2811 1.39e-3 SMART
low complexity region 2835 2860 N/A INTRINSIC
low complexity region 2867 2879 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000127906
AA Change: Y1896F

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: Y1896F

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-95 BLAST
Blast:SPEC 783 894 3e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1357 N/A INTRINSIC
low complexity region 1398 1412 N/A INTRINSIC
PLEC 1422 1458 3.33e-1 SMART
PLEC 1459 1496 3.76e-9 SMART
PLEC 1497 1534 4.09e-10 SMART
PLEC 1535 1572 2.09e-7 SMART
PLEC 1576 1610 4.83e1 SMART
PLEC 1611 1646 5.67e1 SMART
PLEC 1664 1701 1.22e-8 SMART
PLEC 1702 1739 1.16e-9 SMART
PLEC 1740 1777 1.12e-7 SMART
PLEC 1778 1815 1.56e-6 SMART
PLEC 1819 1853 1.42e0 SMART
PLEC 1869 1906 3.7e-8 SMART
low complexity region 1908 1918 N/A INTRINSIC
PLEC 1920 1957 3.73e-4 SMART
low complexity region 1978 1994 N/A INTRINSIC
PLEC 2023 2060 1.46e-6 SMART
PLEC 2061 2098 6.69e-15 SMART
PLEC 2099 2136 1.98e2 SMART
PLEC 2137 2174 2.35e-10 SMART
PLEC 2175 2212 1.39e-3 SMART
low complexity region 2236 2261 N/A INTRINSIC
low complexity region 2268 2280 N/A INTRINSIC
Meta Mutation Damage Score 0.0630 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 A T 3: 95,679,608 Y811N possibly damaging Het
Adrm1 T C 2: 180,175,147 probably benign Het
Alms1 T A 6: 85,621,821 S1210T probably benign Het
Ampd3 C T 7: 110,777,808 P11L probably damaging Het
Arhgap5 A G 12: 52,516,507 E87G possibly damaging Het
Armc5 C T 7: 128,240,070 probably benign Het
Asic2 C G 11: 80,971,456 probably benign Het
Asph A G 4: 9,514,683 probably benign Het
Bicd2 T A 13: 49,377,875 probably null Het
Brip1 A G 11: 86,143,305 L530P possibly damaging Het
Bsn G T 9: 108,111,360 probably benign Het
Btnl4 T A 17: 34,469,634 H390L probably benign Het
Ccdc70 A C 8: 21,973,308 K38T probably damaging Het
Ccni G A 5: 93,202,316 P35S probably benign Het
Cdh17 A G 4: 11,810,451 D714G possibly damaging Het
Cenpf A G 1: 189,653,984 L2033P probably damaging Het
Cfap69 A T 5: 5,621,924 M328K probably damaging Het
Cmah T G 13: 24,417,210 probably null Het
Cog6 T C 3: 53,010,629 T163A probably benign Het
Cyp2j8 G A 4: 96,501,196 S130F probably benign Het
Dgki A G 6: 37,012,896 V636A probably damaging Het
Dmkn T A 7: 30,764,786 probably benign Het
Dnah6 A G 6: 73,035,293 I3679T possibly damaging Het
Exosc4 C T 15: 76,329,489 A171V probably benign Het
Fbxw24 A G 9: 109,623,509 probably benign Het
Flvcr1 A T 1: 191,025,582 L171Q probably damaging Het
Fsd1 G T 17: 55,996,445 probably null Het
Gm7732 A G 17: 21,129,844 noncoding transcript Het
H2-K2 A C 17: 33,975,623 noncoding transcript Het
Hgf A G 5: 16,593,859 N295S probably damaging Het
Ift88 T A 14: 57,517,413 D811E probably benign Het
Igsf9b T A 9: 27,323,361 probably null Het
Immt T A 6: 71,863,172 V311E probably damaging Het
Ipo11 T A 13: 106,919,611 N51I possibly damaging Het
Isy1 T C 6: 87,819,176 K260E probably damaging Het
Jchain T G 5: 88,526,202 I28L probably benign Het
Jmjd1c T A 10: 67,218,946 probably null Het
Kif13b T C 14: 64,751,662 probably benign Het
Klhdc7b T C 15: 89,388,169 Y427H possibly damaging Het
Klhl8 T C 5: 103,876,293 probably benign Het
Lrp2 C T 2: 69,510,948 D963N probably damaging Het
Ltbp3 G T 19: 5,746,748 probably benign Het
Ltf C A 9: 111,040,379 Q41K probably benign Het
Med4 T A 14: 73,516,657 I148N probably damaging Het
Mlh3 T G 12: 85,247,697 S1242R possibly damaging Het
Mllt6 T C 11: 97,676,359 probably benign Het
Mpdz A G 4: 81,292,473 I1712T possibly damaging Het
Mrgprb4 T A 7: 48,198,553 H209L probably benign Het
Nkapl A T 13: 21,468,440 M1K probably null Het
Nmur2 T A 11: 56,029,498 probably benign Het
Nsun2 T A 13: 69,543,697 probably benign Het
Olfr1082 G A 2: 86,594,081 T249I probably benign Het
Olfr1130 A G 2: 87,607,927 I180V probably benign Het
Ovgp1 T C 3: 105,974,830 probably benign Het
Pcdh8 A G 14: 79,770,691 V144A possibly damaging Het
Pcnx3 G A 19: 5,677,728 probably benign Het
Pla2r1 C A 2: 60,479,530 V570L possibly damaging Het
Plxnd1 C A 6: 115,966,638 E1202D possibly damaging Het
Ppp1r37 T C 7: 19,532,254 E529G probably benign Het
Prdm15 A G 16: 97,812,633 F496L possibly damaging Het
Prlhr A T 19: 60,468,005 V41D probably benign Het
Prlhr G T 19: 60,468,059 S23* probably null Het
Prpf4 C T 4: 62,414,540 probably benign Het
Psg26 C T 7: 18,475,235 R416H probably benign Het
Psg26 T C 7: 18,478,287 H381R probably benign Het
Ralgds T G 2: 28,549,116 M717R probably benign Het
Rbms1 T C 2: 60,842,412 N44D probably damaging Het
Rpa1 T C 11: 75,318,401 probably benign Het
Rprd2 T C 3: 95,766,387 N568S probably benign Het
Rptor A G 11: 119,872,376 M929V probably benign Het
Rspo1 T A 4: 125,007,149 C97S possibly damaging Het
Scin C T 12: 40,079,607 G396S probably damaging Het
Scn9a T C 2: 66,547,112 N409D probably damaging Het
Sf3b1 A G 1: 55,019,385 I15T probably damaging Het
Sh3bp2 T C 5: 34,555,495 V149A probably damaging Het
Slc39a12 T A 2: 14,407,426 probably benign Het
Sp9 G T 2: 73,273,827 A242S possibly damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tatdn3 G T 1: 191,052,849 probably benign Het
Tex14 G A 11: 87,499,613 V379I probably benign Het
Tmed6 T C 8: 107,061,724 N197S probably damaging Het
Ttbk2 G A 2: 120,748,575 L689F probably benign Het
Ttbk2 A T 2: 120,745,160 I1043N probably benign Het
Ttn A G 2: 76,810,696 S5283P probably damaging Het
Ube3b C A 5: 114,402,555 S441* probably null Het
Ush2a G A 1: 188,797,830 C3272Y probably damaging Het
Vac14 T A 8: 110,632,477 I95K probably damaging Het
Vangl2 G A 1: 172,006,217 A433V probably damaging Het
Vwa5b1 A T 4: 138,608,824 V153D probably damaging Het
Zfhx3 T A 8: 108,955,650 D3240E unknown Het
Zfp945 A G 17: 22,851,030 C632R probably damaging Het
Zfyve26 G A 12: 79,265,802 probably benign Het
Zyg11b A T 4: 108,242,076 I606N possibly damaging Het
Other mutations in Dsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Dsp APN 13 38197846 missense probably damaging 0.99
IGL01337:Dsp APN 13 38192687 missense probably benign 0.44
IGL01371:Dsp APN 13 38193617 missense probably benign 0.13
IGL01473:Dsp APN 13 38167571 missense probably damaging 0.99
IGL01660:Dsp APN 13 38176495 missense possibly damaging 0.90
IGL01723:Dsp APN 13 38179084 missense probably damaging 1.00
IGL01999:Dsp APN 13 38181186 missense probably damaging 0.99
IGL02313:Dsp APN 13 38196523 nonsense probably null
IGL02833:Dsp APN 13 38192921 missense possibly damaging 0.56
IGL03050:Dsp APN 13 38188445 splice site probably benign
IGL03353:Dsp APN 13 38186695 missense probably damaging 1.00
R0052:Dsp UTSW 13 38197364 missense possibly damaging 0.93
R0052:Dsp UTSW 13 38197364 missense possibly damaging 0.93
R0078:Dsp UTSW 13 38196017 missense probably benign 0.22
R0230:Dsp UTSW 13 38197705 missense probably benign 0.03
R0234:Dsp UTSW 13 38187893 missense probably benign 0.13
R0234:Dsp UTSW 13 38187893 missense probably benign 0.13
R0285:Dsp UTSW 13 38172794 missense probably benign
R0326:Dsp UTSW 13 38192870 nonsense probably null
R0332:Dsp UTSW 13 38182228 nonsense probably null
R0471:Dsp UTSW 13 38193350 nonsense probably null
R0567:Dsp UTSW 13 38192438 missense probably benign 0.01
R0611:Dsp UTSW 13 38187741 missense probably damaging 1.00
R0926:Dsp UTSW 13 38183218 missense probably damaging 0.97
R1078:Dsp UTSW 13 38183106 splice site probably benign
R1183:Dsp UTSW 13 38191740 nonsense probably null
R1188:Dsp UTSW 13 38194963 missense probably damaging 1.00
R1419:Dsp UTSW 13 38186695 missense probably damaging 1.00
R1445:Dsp UTSW 13 38191931 missense probably damaging 0.98
R1467:Dsp UTSW 13 38192712 missense probably benign 0.00
R1467:Dsp UTSW 13 38192712 missense probably benign 0.00
R1478:Dsp UTSW 13 38181138 missense probably damaging 1.00
R1568:Dsp UTSW 13 38175147 missense probably damaging 1.00
R1572:Dsp UTSW 13 38195738 missense probably damaging 1.00
R1676:Dsp UTSW 13 38193374 nonsense probably null
R1736:Dsp UTSW 13 38192990 missense probably benign 0.01
R1776:Dsp UTSW 13 38196617 missense probably damaging 0.99
R1829:Dsp UTSW 13 38193195 missense probably damaging 1.00
R1878:Dsp UTSW 13 38164855 missense possibly damaging 0.53
R2013:Dsp UTSW 13 38191458 missense probably damaging 1.00
R2161:Dsp UTSW 13 38196451 missense probably damaging 1.00
R2187:Dsp UTSW 13 38176407 missense probably damaging 1.00
R2295:Dsp UTSW 13 38197046 missense probably benign 0.28
R2495:Dsp UTSW 13 38193477 missense possibly damaging 0.91
R2566:Dsp UTSW 13 38196404 missense probably damaging 1.00
R2888:Dsp UTSW 13 38192248 missense possibly damaging 0.92
R3012:Dsp UTSW 13 38193342 missense possibly damaging 0.61
R3614:Dsp UTSW 13 38177199 missense probably damaging 0.98
R3725:Dsp UTSW 13 38194689 splice site probably null
R3725:Dsp UTSW 13 38197618 missense probably benign 0.00
R3797:Dsp UTSW 13 38177284 critical splice donor site probably null
R3841:Dsp UTSW 13 38197705 missense probably benign
R4030:Dsp UTSW 13 38191428 missense possibly damaging 0.84
R4124:Dsp UTSW 13 38186713 missense probably damaging 1.00
R4279:Dsp UTSW 13 38185231 missense probably damaging 1.00
R4334:Dsp UTSW 13 38196664 missense possibly damaging 0.46
R4419:Dsp UTSW 13 38195132 missense probably damaging 1.00
R4615:Dsp UTSW 13 38191632 missense probably damaging 0.98
R4627:Dsp UTSW 13 38168641 missense probably benign 0.01
R4639:Dsp UTSW 13 38196784 missense probably damaging 1.00
R4687:Dsp UTSW 13 38191619 missense probably damaging 1.00
R4735:Dsp UTSW 13 38196040 missense probably damaging 0.99
R4746:Dsp UTSW 13 38195104 missense possibly damaging 0.51
R4772:Dsp UTSW 13 38167528 nonsense probably null
R4830:Dsp UTSW 13 38192864 missense probably benign
R4850:Dsp UTSW 13 38192469 missense probably damaging 1.00
R4959:Dsp UTSW 13 38191710 missense probably benign 0.41
R4963:Dsp UTSW 13 38197870 missense probably damaging 0.99
R4969:Dsp UTSW 13 38192910 missense probably benign 0.00
R4978:Dsp UTSW 13 38182234 missense probably damaging 1.00
R4989:Dsp UTSW 13 38197702 missense possibly damaging 0.93
R5068:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5069:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5070:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5133:Dsp UTSW 13 38197702 missense possibly damaging 0.93
R5138:Dsp UTSW 13 38183298 missense probably benign 0.37
R5138:Dsp UTSW 13 38195845 missense possibly damaging 0.50
R5153:Dsp UTSW 13 38182306 missense probably damaging 1.00
R5199:Dsp UTSW 13 38192902 nonsense probably null
R5226:Dsp UTSW 13 38186770 missense probably damaging 0.99
R5265:Dsp UTSW 13 38195183 missense possibly damaging 0.95
R5371:Dsp UTSW 13 38194889 missense probably damaging 0.97
R5484:Dsp UTSW 13 38184038 missense possibly damaging 0.48
R5534:Dsp UTSW 13 38195842 missense probably benign 0.01
R5569:Dsp UTSW 13 38192652 missense probably benign 0.01
R5854:Dsp UTSW 13 38167501 splice site probably null
R5910:Dsp UTSW 13 38192469 missense possibly damaging 0.95
R5929:Dsp UTSW 13 38195434 missense possibly damaging 0.92
R5940:Dsp UTSW 13 38196026 missense possibly damaging 0.70
R5948:Dsp UTSW 13 38195401 missense possibly damaging 0.95
R5955:Dsp UTSW 13 38194958 missense possibly damaging 0.73
R5970:Dsp UTSW 13 38195702 missense possibly damaging 0.93
R6054:Dsp UTSW 13 38167609 missense probably benign 0.00
R6113:Dsp UTSW 13 38192047 missense probably damaging 1.00
R6139:Dsp UTSW 13 38192406 missense probably damaging 0.97
R6328:Dsp UTSW 13 38197006 nonsense probably null
R6527:Dsp UTSW 13 38195873 missense probably damaging 1.00
R6573:Dsp UTSW 13 38196862 missense probably damaging 1.00
R6628:Dsp UTSW 13 38167622 missense possibly damaging 0.73
R6738:Dsp UTSW 13 38192210 missense possibly damaging 0.87
R6898:Dsp UTSW 13 38192217 missense possibly damaging 0.59
R6919:Dsp UTSW 13 38167655 missense possibly damaging 0.84
R6951:Dsp UTSW 13 38167646 missense possibly damaging 0.95
R7017:Dsp UTSW 13 38186707 missense probably benign 0.02
R7022:Dsp UTSW 13 38191740 missense probably benign 0.06
R7135:Dsp UTSW 13 38179073 missense probably damaging 1.00
R7192:Dsp UTSW 13 38195593 missense probably benign 0.09
R7211:Dsp UTSW 13 38188535 critical splice donor site probably null
R7251:Dsp UTSW 13 38193548 missense probably benign 0.02
R7326:Dsp UTSW 13 38192883 missense probably benign 0.01
R7369:Dsp UTSW 13 38197525 missense possibly damaging 0.82
R7376:Dsp UTSW 13 38172843 missense probably damaging 1.00
R7406:Dsp UTSW 13 38197196 missense possibly damaging 0.63
R7439:Dsp UTSW 13 38176502 critical splice donor site probably null
R7439:Dsp UTSW 13 38195449 missense probably benign 0.00
R7441:Dsp UTSW 13 38195449 missense probably benign 0.00
R7477:Dsp UTSW 13 38172863 missense probably damaging 1.00
R7535:Dsp UTSW 13 38192789 missense probably benign 0.05
R7558:Dsp UTSW 13 38168766 missense probably benign 0.02
R7600:Dsp UTSW 13 38191715 missense probably damaging 1.00
R7616:Dsp UTSW 13 38191482 missense probably damaging 0.98
R7702:Dsp UTSW 13 38175207 missense possibly damaging 0.83
R7738:Dsp UTSW 13 38185175 missense probably damaging 0.97
R7815:Dsp UTSW 13 38191470 missense probably benign 0.31
X0023:Dsp UTSW 13 38197684 missense probably benign 0.00
X0024:Dsp UTSW 13 38193255 missense probably benign 0.04
X0027:Dsp UTSW 13 38186646 missense possibly damaging 0.68
X0067:Dsp UTSW 13 38182312 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GCTTAGCGAAATCCTCTCAGACCC -3'
(R):5'- AACGAGGCCCTTGTCAATAGCATC -3'

Sequencing Primer
(F):5'- GGCTTTTTCGATCCAAACACAG -3'
(R):5'- GCCCTTGTCAATAGCATCTTGAATG -3'
Posted On2015-02-04