Incidental Mutation 'R0014:Polr2g'
ID262077
Institutional Source Beutler Lab
Gene Symbol Polr2g
Ensembl Gene ENSMUSG00000071662
Gene Namepolymerase (RNA) II (DNA directed) polypeptide G
Synonyms2410046K11Rik, RBP7, A230108L04Rik, Rpo2-7l
MMRRC Submission 038309-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R0014 (G1)
Quality Score54
Status Validated
Chromosome19
Chromosomal Location8793129-8798557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8793652 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 160 (I160T)
Ref Sequence ENSEMBL: ENSMUSP00000093980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096261]
Predicted Effect probably damaging
Transcript: ENSMUST00000096261
AA Change: I160T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093980
Gene: ENSMUSG00000071662
AA Change: I160T

DomainStartEndE-ValueType
Pfam:SHS2_Rpb7-N 8 77 1e-18 PFAM
S1 80 162 1.75e-4 SMART
Meta Mutation Damage Score 0.4096 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the seventh largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The protein functions in transcription initiation, and is also thought to help stabilize transcribing polyermase molecules during elongation. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130409I23Rik T C 1: 181,055,131 F153L possibly damaging Het
A1bg T A 15: 60,919,732 D92V probably damaging Het
Ankrd52 C A 10: 128,386,452 T583K probably benign Het
C3ar1 C T 6: 122,850,851 V136M probably damaging Het
Capg A G 6: 72,561,043 E304G possibly damaging Het
Ccdc125 A C 13: 100,684,338 N189T possibly damaging Het
Ccr5 T C 9: 124,124,621 F87S probably damaging Het
Cd2ap T C 17: 42,807,928 S540G probably benign Het
Cdt1 C T 8: 122,572,566 T529M probably benign Het
Cfap126 A G 1: 171,125,784 D49G possibly damaging Het
Cngb3 T C 4: 19,396,685 I346T probably benign Het
Dgkd A G 1: 87,881,881 D97G probably damaging Het
Dgkg A T 16: 22,565,364 probably null Het
Dmbx1 G T 4: 115,918,024 T358K probably damaging Het
Epc2 A T 2: 49,522,525 K172* probably null Het
F2rl2 A T 13: 95,700,909 N154I probably damaging Het
Fyttd1 G A 16: 32,905,554 R175Q probably damaging Het
Gbp5 T A 3: 142,506,735 C395S probably damaging Het
Gen1 T C 12: 11,241,641 N716D probably benign Het
Helz2 A G 2: 181,240,511 L163P probably damaging Het
Hmox2 T A 16: 4,765,033 L210Q probably damaging Het
Klhl28 T C 12: 64,957,302 T146A probably benign Het
Lrrk2 T C 15: 91,802,045 probably benign Het
Man2c1 T A 9: 57,139,701 M580K probably benign Het
Neb G A 2: 52,287,156 A1391V probably damaging Het
Nyap2 T C 1: 81,241,951 S563P probably damaging Het
Olfr1301 A G 2: 111,754,774 D175G probably damaging Het
Olfr520 T C 7: 99,736,049 V302A probably damaging Het
Olfr543 A G 7: 102,477,477 I131T probably damaging Het
P2rx5 T A 11: 73,167,062 probably benign Het
Pclo C T 5: 14,680,451 probably benign Het
Pex1 G A 5: 3,626,141 probably benign Het
Psma8 A G 18: 14,726,530 I86V possibly damaging Het
Ptpdc1 G T 13: 48,586,919 Y345* probably null Het
Rcbtb1 G T 14: 59,235,242 K493N probably benign Het
Rexo2 A T 9: 48,474,447 S126T probably benign Het
Rorc T A 3: 94,377,613 probably benign Het
Slc7a2 T C 8: 40,911,028 L426P probably damaging Het
Syde1 T C 10: 78,590,034 T100A probably benign Het
Tbc1d20 A T 2: 152,311,781 Q342L probably benign Het
Thbs1 A G 2: 118,113,350 T150A possibly damaging Het
Trpm1 A G 7: 64,248,222 H317R probably damaging Het
Tut1 T A 19: 8,962,447 L265Q possibly damaging Het
Wdfy4 A G 14: 33,107,173 F1029L possibly damaging Het
Wdr63 T C 3: 146,081,423 probably null Het
Wdr7 A G 18: 63,904,101 T1199A probably benign Het
Zfp458 A G 13: 67,258,090 V95A possibly damaging Het
Zscan18 A T 7: 12,769,417 F738L possibly damaging Het
Other mutations in Polr2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Polr2g APN 19 8794376 splice site probably benign
IGL02474:Polr2g APN 19 8798456 splice site probably null
IGL03346:Polr2g APN 19 8798305 missense probably damaging 1.00
R0015:Polr2g UTSW 19 8793652 missense probably damaging 0.99
R0015:Polr2g UTSW 19 8793652 missense probably damaging 0.99
R5372:Polr2g UTSW 19 8797303 missense probably damaging 1.00
R6073:Polr2g UTSW 19 8797309 missense probably damaging 0.99
R6177:Polr2g UTSW 19 8794177 missense probably damaging 1.00
R8213:Polr2g UTSW 19 8798257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCACGAGCCCTATGAGATCAG -3'
(R):5'- TGTGTAGCAAGCTCTTTCACCACC -3'

Sequencing Primer
(F):5'- TCAGTCAGACACCGAGTTCC -3'
(R):5'- gctctttcaccacctgcac -3'
Posted On2015-02-04