Incidental Mutation 'T0975:Toe1'
ID262136
Institutional Source Beutler Lab
Gene Symbol Toe1
Ensembl Gene ENSMUSG00000028688
Gene Nametarget of EGR1, member 1 (nuclear)
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #T0975 (G3) of strain 714
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location116794310-116807640 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116806093 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 62 (I62M)
Ref Sequence ENSEMBL: ENSMUSP00000117019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030451] [ENSMUST00000045542] [ENSMUST00000102699] [ENSMUST00000106455] [ENSMUST00000106456] [ENSMUST00000106459] [ENSMUST00000130359] [ENSMUST00000145468]
Predicted Effect probably benign
Transcript: ENSMUST00000030451
AA Change: I128M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030451
Gene: ENSMUSG00000028688
AA Change: I128M

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:CAF1 39 171 3.1e-46 PFAM
Pfam:CAF1 164 452 9.9e-40 PFAM
Pfam:zf-CCCH 297 322 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045542
SMART Domains Protein: ENSMUSP00000041009
Gene: ENSMUSG00000033985

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase 59 309 1.6e-48 PFAM
Pfam:Pkinase_Tyr 59 309 1.2e-50 PFAM
low complexity region 539 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102699
SMART Domains Protein: ENSMUSP00000099760
Gene: ENSMUSG00000028687

DomainStartEndE-ValueType
ENDO3c 107 259 1.46e-52 SMART
FES 260 280 2.16e-5 SMART
Pfam:NUDIX_4 353 463 2.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106455
AA Change: I128M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102063
Gene: ENSMUSG00000028688
AA Change: I128M

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:CAF1 37 301 2.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106456
SMART Domains Protein: ENSMUSP00000102064
Gene: ENSMUSG00000033985

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase_Tyr 59 291 4.5e-46 PFAM
Pfam:Pkinase 60 332 3.6e-46 PFAM
low complexity region 510 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106459
SMART Domains Protein: ENSMUSP00000102067
Gene: ENSMUSG00000033985

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase_Tyr 59 238 6.1e-37 PFAM
Pfam:Pkinase 60 239 4.3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124857
Predicted Effect probably benign
Transcript: ENSMUST00000130359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142529
Predicted Effect probably benign
Transcript: ENSMUST00000145468
AA Change: I62M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117019
Gene: ENSMUSG00000028688
AA Change: I62M

DomainStartEndE-ValueType
Pfam:CAF1 1 184 2.2e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154195
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik TAA TAAA 11: 3,937,945 probably null Het
4930556J24Rik C T 11: 3,976,324 A27T unknown Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bpifb5 C A 2: 154,229,464 probably null Het
Ccdc157 C T 11: 4,146,246 A455T probably damaging Het
Ccng1 A C 11: 40,754,044 S9A probably benign Het
Cfh T C 1: 140,154,598 T164A probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Chrng T C 1: 87,210,626 S380P probably benign Het
Clspn ACGGCGGCGGCGGCG ACGGCGGCGGCGGCGGCGGCG 4: 126,566,437 probably benign Het
Ctrc T TA 4: 141,845,196 probably null Het
Cxxc1 C T 18: 74,220,921 R593C probably damaging Het
Dlgap1 T C 17: 70,516,955 S312P possibly damaging Het
Dnah10 A G 5: 124,763,066 S1255G probably benign Het
Dpep1 A T 8: 123,200,988 S388C probably damaging Het
Emid1 A C 11: 5,128,884 L353V probably benign Het
Emid1 T C 11: 5,144,386 T42A probably damaging Het
Epn3 A G 11: 94,491,907 probably null Het
Fam124b T C 1: 80,213,126 E180G probably benign Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Gatsl3 G C 11: 4,220,445 G147A probably benign Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm7534 GTG GTGCTG 4: 134,202,629 probably benign Het
Gm9972 GA GAA 11: 43,036,770 probably null Het
Hmmr G C 11: 40,723,416 N148K probably damaging Het
Homez C T 14: 54,857,339 R304K possibly damaging Het
Ifngr1 G A 10: 19,609,473 V407M probably damaging Het
Inpp5j G T 11: 3,502,527 T241N possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kremen1 C T 11: 5,195,105 A424T probably benign Het
Mat2b G A 11: 40,680,091 T302I probably benign Het
Mtmr3 C T 11: 4,488,441 R671K probably benign Het
Nacad GCAGGGTCAGGGTC GCAGGGTCAGGGTCAGGGTC 11: 6,599,750 probably benign Het
Nacad T C 11: 6,601,622 N523S probably benign Het
Nacad A G 11: 6,601,632 C520R probably benign Het
Nefh G A 11: 4,940,151 P823S probably benign Het
Nfrkb G C 9: 31,397,083 A230P probably benign Het
Nlrp4a A G 7: 26,449,637 E223G probably damaging Het
Notch3 T A 17: 32,146,417 Y1107F probably damaging Het
Olfr1331 G T 4: 118,869,303 R174M probably benign Het
Olfr309 A T 7: 86,306,284 Y276* probably null Het
Olfr781 A G 10: 129,333,445 D188G probably benign Het
Osm A G 11: 4,239,588 D124G probably benign Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Sytl1 TCTGC TC 4: 133,256,994 probably benign Het
Tcn2 G C 11: 3,923,487 F286L possibly damaging Het
Tg T C 15: 66,688,863 S10P probably benign Het
Tmprss7 C T 16: 45,680,733 R235Q probably benign Het
Tns3 G T 11: 8,451,146 L1051M probably benign Het
Tns3 T G 11: 8,479,518 E806A probably benign Het
Tns3 G A 11: 8,549,100 probably benign Het
Txnrd2 A G 16: 18,475,565 H436R probably damaging Het
Ubr4 C T 4: 139,451,781 P2001S probably damaging Het
Vmn2r23 T A 6: 123,713,161 M332K probably benign Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zfyve21 A G 12: 111,827,633 D206G probably damaging Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Toe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Toe1 APN 4 116806330 missense possibly damaging 0.83
F5770:Toe1 UTSW 4 116806111 missense probably damaging 1.00
PIT4486001:Toe1 UTSW 4 116806495 missense probably damaging 1.00
R0501:Toe1 UTSW 4 116807485 missense probably benign
R0639:Toe1 UTSW 4 116806750 missense probably benign
R1768:Toe1 UTSW 4 116804879 missense probably benign 0.04
R1860:Toe1 UTSW 4 116805229 missense probably damaging 1.00
R2926:Toe1 UTSW 4 116804980 missense possibly damaging 0.67
R4722:Toe1 UTSW 4 116805200 missense probably damaging 1.00
R4926:Toe1 UTSW 4 116804532 missense probably damaging 0.99
R5195:Toe1 UTSW 4 116804655 missense probably damaging 1.00
R6898:Toe1 UTSW 4 116807474 missense probably damaging 1.00
R7241:Toe1 UTSW 4 116807518 start codon destroyed probably null 0.95
T0722:Toe1 UTSW 4 116806093 missense probably benign 0.00
V7581:Toe1 UTSW 4 116806111 missense probably damaging 1.00
V7582:Toe1 UTSW 4 116806111 missense probably damaging 1.00
V7583:Toe1 UTSW 4 116806111 missense probably damaging 1.00
X0028:Toe1 UTSW 4 116806052 missense probably damaging 1.00
Predicted Primers
Posted On2015-02-04