Incidental Mutation 'T0975:Olfr1331'
ID262137
Institutional Source Beutler Lab
Gene Symbol Olfr1331
Ensembl Gene ENSMUSG00000073769
Gene Nameolfactory receptor 1331
SynonymsMOR259-3P, GA_x6K02T2QD9B-18670866-18669913
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #T0975 (G3) of strain 714
Quality Score148
Status Not validated
Chromosome4
Chromosomal Location118864649-118871707 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 118869303 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Methionine at position 174 (R174M)
Ref Sequence ENSEMBL: ENSMUSP00000101967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094831] [ENSMUST00000106360] [ENSMUST00000216589]
Predicted Effect probably benign
Transcript: ENSMUST00000094831
AA Change: R174M

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000092426
Gene: ENSMUSG00000073769
AA Change: R174M

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.1e-53 PFAM
Pfam:7tm_1 42 291 3.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106360
AA Change: R174M

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000101967
Gene: ENSMUSG00000073769
AA Change: R174M

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 1.2e-28 PFAM
Pfam:7tm_4 139 283 2.8e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216589
AA Change: R173M

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik TAA TAAA 11: 3,937,945 probably null Het
4930556J24Rik C T 11: 3,976,324 A27T unknown Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bpifb5 C A 2: 154,229,464 probably null Het
Ccdc157 C T 11: 4,146,246 A455T probably damaging Het
Ccng1 A C 11: 40,754,044 S9A probably benign Het
Cfh T C 1: 140,154,598 T164A probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Chrng T C 1: 87,210,626 S380P probably benign Het
Clspn ACGGCGGCGGCGGCG ACGGCGGCGGCGGCGGCGGCG 4: 126,566,437 probably benign Het
Ctrc T TA 4: 141,845,196 probably null Het
Cxxc1 C T 18: 74,220,921 R593C probably damaging Het
Dlgap1 T C 17: 70,516,955 S312P possibly damaging Het
Dnah10 A G 5: 124,763,066 S1255G probably benign Het
Dpep1 A T 8: 123,200,988 S388C probably damaging Het
Emid1 A C 11: 5,128,884 L353V probably benign Het
Emid1 T C 11: 5,144,386 T42A probably damaging Het
Epn3 A G 11: 94,491,907 probably null Het
Fam124b T C 1: 80,213,126 E180G probably benign Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Gatsl3 G C 11: 4,220,445 G147A probably benign Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm7534 GTG GTGCTG 4: 134,202,629 probably benign Het
Gm9972 GA GAA 11: 43,036,770 probably null Het
Hmmr G C 11: 40,723,416 N148K probably damaging Het
Homez C T 14: 54,857,339 R304K possibly damaging Het
Ifngr1 G A 10: 19,609,473 V407M probably damaging Het
Inpp5j G T 11: 3,502,527 T241N possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kremen1 C T 11: 5,195,105 A424T probably benign Het
Mat2b G A 11: 40,680,091 T302I probably benign Het
Mtmr3 C T 11: 4,488,441 R671K probably benign Het
Nacad GCAGGGTCAGGGTC GCAGGGTCAGGGTCAGGGTC 11: 6,599,750 probably benign Het
Nacad T C 11: 6,601,622 N523S probably benign Het
Nacad A G 11: 6,601,632 C520R probably benign Het
Nefh G A 11: 4,940,151 P823S probably benign Het
Nfrkb G C 9: 31,397,083 A230P probably benign Het
Nlrp4a A G 7: 26,449,637 E223G probably damaging Het
Notch3 T A 17: 32,146,417 Y1107F probably damaging Het
Olfr309 A T 7: 86,306,284 Y276* probably null Het
Olfr781 A G 10: 129,333,445 D188G probably benign Het
Osm A G 11: 4,239,588 D124G probably benign Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Sytl1 TCTGC TC 4: 133,256,994 probably benign Het
Tcn2 G C 11: 3,923,487 F286L possibly damaging Het
Tg T C 15: 66,688,863 S10P probably benign Het
Tmprss7 C T 16: 45,680,733 R235Q probably benign Het
Tns3 G T 11: 8,451,146 L1051M probably benign Het
Tns3 T G 11: 8,479,518 E806A probably benign Het
Tns3 G A 11: 8,549,100 probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Txnrd2 A G 16: 18,475,565 H436R probably damaging Het
Ubr4 C T 4: 139,451,781 P2001S probably damaging Het
Vmn2r23 T A 6: 123,713,161 M332K probably benign Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zfyve21 A G 12: 111,827,633 D206G probably damaging Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Olfr1331
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Olfr1331 APN 4 118869287 missense probably damaging 1.00
IGL01314:Olfr1331 APN 4 118869131 missense probably benign 0.26
IGL02025:Olfr1331 APN 4 118869165 missense probably damaging 1.00
IGL02458:Olfr1331 APN 4 118869300 missense possibly damaging 0.83
IGL02793:Olfr1331 APN 4 118869597 missense probably damaging 1.00
IGL02827:Olfr1331 APN 4 118868960 missense probably damaging 0.99
IGL02863:Olfr1331 APN 4 118868886 missense possibly damaging 0.52
IGL03125:Olfr1331 APN 4 118868921 missense possibly damaging 0.95
R0078:Olfr1331 UTSW 4 118869227 missense probably benign
R0152:Olfr1331 UTSW 4 118868886 missense possibly damaging 0.89
R0299:Olfr1331 UTSW 4 118869416 missense probably benign 0.00
R3881:Olfr1331 UTSW 4 118869353 missense probably benign 0.00
R3928:Olfr1331 UTSW 4 118868982 missense probably damaging 1.00
R3929:Olfr1331 UTSW 4 118868982 missense probably damaging 1.00
R5288:Olfr1331 UTSW 4 118869575 missense probably damaging 1.00
R5552:Olfr1331 UTSW 4 118869468 missense probably damaging 1.00
R5672:Olfr1331 UTSW 4 118869182 missense possibly damaging 0.83
R5773:Olfr1331 UTSW 4 118869521 missense probably damaging 0.97
R6117:Olfr1331 UTSW 4 118869144 missense probably benign 0.39
R6910:Olfr1331 UTSW 4 118869138 missense probably damaging 1.00
R6911:Olfr1331 UTSW 4 118869138 missense probably damaging 1.00
R6912:Olfr1331 UTSW 4 118869138 missense probably damaging 1.00
R7164:Olfr1331 UTSW 4 118869725 missense probably benign 0.30
R7446:Olfr1331 UTSW 4 118868822 missense possibly damaging 0.83
Predicted Primers
Posted On2015-02-04