Incidental Mutation 'T0975:Azin2'
ID262149
Institutional Source Beutler Lab
Gene Symbol Azin2
Ensembl Gene ENSMUSG00000028789
Gene Nameantizyme inhibitor 2
SynonymsAZIN2, Odcp, 4933429I20Rik, Adc
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #T0975 (G3) of strain 714
Quality Score201
Status Not validated
Chromosome4
Chromosomal Location128930233-128962442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128946134 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 222 (Y222H)
Ref Sequence ENSEMBL: ENSMUSP00000114086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030581] [ENSMUST00000106068] [ENSMUST00000119354] [ENSMUST00000147731]
Predicted Effect probably benign
Transcript: ENSMUST00000030581
AA Change: Y317H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030581
Gene: ENSMUSG00000028789
AA Change: Y317H

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 45 283 1.9e-69 PFAM
Pfam:Orn_DAP_Arg_deC 286 407 1.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106068
AA Change: Y317H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101683
Gene: ENSMUSG00000028789
AA Change: Y317H

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 45 283 6.7e-73 PFAM
Pfam:Orn_DAP_Arg_deC 287 406 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119354
AA Change: Y222H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114086
Gene: ENSMUSG00000028789
AA Change: Y222H

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 1 188 4.2e-54 PFAM
Pfam:Orn_DAP_Arg_deC 191 312 4.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143912
Predicted Effect probably benign
Transcript: ENSMUST00000147731
SMART Domains Protein: ENSMUSP00000122240
Gene: ENSMUSG00000028789

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 2 202 4e-56 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 2, the second member of this gene family. Like antizyme inhibitor 1, antizyme inhibitor 2 interacts with all 3 antizymes and stimulates ODC activity and polyamine uptake. However, unlike antizyme inhibitor 1, which is ubiquitously expressed and localized in the nucleus and cytoplasm, antizyme inhibitor 2 is predominantly expressed in the brain and testis and localized in the endoplasmic reticulum-golgi intermediate compartment. Recent studies indicate that antizyme inhibitor 2 is also expressed in specific cell types in ovaries, adrenal glands and pancreas, and in mast cells. The exact function of this gene is not known, however, available data suggest its role in cell growth, spermiogenesis, vesicular trafficking and secretion. There has been confusion in literature and databases over the nomenclature of this gene, stemming from an earlier report that a human cDNA clone (identical to ODCp/AZIN2) had arginine decarboxylase (ADC) activity (PMID:14738999). Subsequent studies in human and mouse showed that antizyme inhibitor 2 was devoid of arginine decarboxylase activity (PMID:19956990). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased circulating insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,976,324 A27T unknown Het
4930556J24Rik TAA TAAA 11: 3,937,945 probably null Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Bpifb5 C A 2: 154,229,464 probably null Het
Ccdc157 C T 11: 4,146,246 A455T probably damaging Het
Ccng1 A C 11: 40,754,044 S9A probably benign Het
Cfh T C 1: 140,154,598 T164A probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Chrng T C 1: 87,210,626 S380P probably benign Het
Clspn ACGGCGGCGGCGGCG ACGGCGGCGGCGGCGGCGGCG 4: 126,566,437 probably benign Het
Ctrc T TA 4: 141,845,196 probably null Het
Cxxc1 C T 18: 74,220,921 R593C probably damaging Het
Dlgap1 T C 17: 70,516,955 S312P possibly damaging Het
Dnah10 A G 5: 124,763,066 S1255G probably benign Het
Dpep1 A T 8: 123,200,988 S388C probably damaging Het
Emid1 T C 11: 5,144,386 T42A probably damaging Het
Emid1 A C 11: 5,128,884 L353V probably benign Het
Epn3 A G 11: 94,491,907 probably null Het
Fam124b T C 1: 80,213,126 E180G probably benign Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Gatsl3 G C 11: 4,220,445 G147A probably benign Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm7534 GTG GTGCTG 4: 134,202,629 probably benign Het
Gm9972 GA GAA 11: 43,036,770 probably null Het
Hmmr G C 11: 40,723,416 N148K probably damaging Het
Homez C T 14: 54,857,339 R304K possibly damaging Het
Ifngr1 G A 10: 19,609,473 V407M probably damaging Het
Inpp5j G T 11: 3,502,527 T241N possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kremen1 C T 11: 5,195,105 A424T probably benign Het
Mat2b G A 11: 40,680,091 T302I probably benign Het
Mtmr3 C T 11: 4,488,441 R671K probably benign Het
Nacad GCAGGGTCAGGGTC GCAGGGTCAGGGTCAGGGTC 11: 6,599,750 probably benign Het
Nacad T C 11: 6,601,622 N523S probably benign Het
Nacad A G 11: 6,601,632 C520R probably benign Het
Nefh G A 11: 4,940,151 P823S probably benign Het
Nfrkb G C 9: 31,397,083 A230P probably benign Het
Nlrp4a A G 7: 26,449,637 E223G probably damaging Het
Notch3 T A 17: 32,146,417 Y1107F probably damaging Het
Olfr1331 G T 4: 118,869,303 R174M probably benign Het
Olfr309 A T 7: 86,306,284 Y276* probably null Het
Olfr781 A G 10: 129,333,445 D188G probably benign Het
Osm A G 11: 4,239,588 D124G probably benign Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Sytl1 TCTGC TC 4: 133,256,994 probably benign Het
Tcn2 G C 11: 3,923,487 F286L possibly damaging Het
Tg T C 15: 66,688,863 S10P probably benign Het
Tmprss7 C T 16: 45,680,733 R235Q probably benign Het
Tns3 G T 11: 8,451,146 L1051M probably benign Het
Tns3 T G 11: 8,479,518 E806A probably benign Het
Tns3 G A 11: 8,549,100 probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Txnrd2 A G 16: 18,475,565 H436R probably damaging Het
Ubr4 C T 4: 139,451,781 P2001S probably damaging Het
Vmn2r23 T A 6: 123,713,161 M332K probably benign Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zfyve21 A G 12: 111,827,633 D206G probably damaging Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Azin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Azin2 APN 4 128950666 missense probably damaging 1.00
IGL02040:Azin2 APN 4 128950658 missense possibly damaging 0.78
IGL03349:Azin2 APN 4 128946114 nonsense probably null
R0118:Azin2 UTSW 4 128949637 missense probably damaging 0.97
R1215:Azin2 UTSW 4 128949696 missense probably damaging 0.96
R1940:Azin2 UTSW 4 128950784 splice site probably null
R2939:Azin2 UTSW 4 128934604 missense probably benign 0.44
R4899:Azin2 UTSW 4 128934653 missense probably benign 0.43
R5836:Azin2 UTSW 4 128948877 missense probably damaging 1.00
R6511:Azin2 UTSW 4 128934466 missense probably damaging 1.00
T0722:Azin2 UTSW 4 128946134 missense probably benign 0.00
Z1176:Azin2 UTSW 4 128934659 missense possibly damaging 0.54
Predicted Primers
Posted On2015-02-04