Incidental Mutation 'T0975:Ahdc1'
Institutional Source Beutler Lab
Gene Symbol Ahdc1
Ensembl Gene ENSMUSG00000037692
Gene NameAT hook, DNA binding motif, containing 1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #T0975 (G3) of strain 714
Quality Score108
Status Not validated
Chromosomal Location133011260-133078110 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) ACCTCCT to ACCTCCTCCT at 133062754 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044521] [ENSMUST00000105914] [ENSMUST00000105915] [ENSMUST00000105916]
Predicted Effect probably benign
Transcript: ENSMUST00000044521
SMART Domains Protein: ENSMUSP00000047113
Gene: ENSMUSG00000037692

low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105914
SMART Domains Protein: ENSMUSP00000101534
Gene: ENSMUSG00000037692

low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
Pfam:DUF4683 559 639 6.4e-15 PFAM
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105915
SMART Domains Protein: ENSMUSP00000101535
Gene: ENSMUSG00000037692

low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105916
SMART Domains Protein: ENSMUSP00000101536
Gene: ENSMUSG00000037692

low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156677
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing two AT-hooks, which likely function in DNA binding. Mutations in this gene were found in individuals with Xia-Gibbs syndrome. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,976,324 A27T unknown Het
4930556J24Rik TAA TAAA 11: 3,937,945 probably null Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bpifb5 C A 2: 154,229,464 probably null Het
Ccdc157 C T 11: 4,146,246 A455T probably damaging Het
Ccng1 A C 11: 40,754,044 S9A probably benign Het
Cfh T C 1: 140,154,598 T164A probably benign Het
Chrng T C 1: 87,210,626 S380P probably benign Het
Clspn ACGGCGGCGGCGGCG ACGGCGGCGGCGGCGGCGGCG 4: 126,566,437 probably benign Het
Ctrc T TA 4: 141,845,196 probably null Het
Cxxc1 C T 18: 74,220,921 R593C probably damaging Het
Dlgap1 T C 17: 70,516,955 S312P possibly damaging Het
Dnah10 A G 5: 124,763,066 S1255G probably benign Het
Dpep1 A T 8: 123,200,988 S388C probably damaging Het
Emid1 T C 11: 5,144,386 T42A probably damaging Het
Emid1 A C 11: 5,128,884 L353V probably benign Het
Epn3 A G 11: 94,491,907 probably null Het
Fam124b T C 1: 80,213,126 E180G probably benign Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Gatsl3 G C 11: 4,220,445 G147A probably benign Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm7534 GTG GTGCTG 4: 134,202,629 probably benign Het
Gm9972 GA GAA 11: 43,036,770 probably null Het
Hmmr G C 11: 40,723,416 N148K probably damaging Het
Homez C T 14: 54,857,339 R304K possibly damaging Het
Ifngr1 G A 10: 19,609,473 V407M probably damaging Het
Inpp5j G T 11: 3,502,527 T241N possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kremen1 C T 11: 5,195,105 A424T probably benign Het
Mat2b G A 11: 40,680,091 T302I probably benign Het
Mtmr3 C T 11: 4,488,441 R671K probably benign Het
Nacad GCAGGGTCAGGGTC GCAGGGTCAGGGTCAGGGTC 11: 6,599,750 probably benign Het
Nacad T C 11: 6,601,622 N523S probably benign Het
Nacad A G 11: 6,601,632 C520R probably benign Het
Nefh G A 11: 4,940,151 P823S probably benign Het
Nfrkb G C 9: 31,397,083 A230P probably benign Het
Nlrp4a A G 7: 26,449,637 E223G probably damaging Het
Notch3 T A 17: 32,146,417 Y1107F probably damaging Het
Olfr1331 G T 4: 118,869,303 R174M probably benign Het
Olfr309 A T 7: 86,306,284 Y276* probably null Het
Olfr781 A G 10: 129,333,445 D188G probably benign Het
Osm A G 11: 4,239,588 D124G probably benign Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Sytl1 TCTGC TC 4: 133,256,994 probably benign Het
Tcn2 G C 11: 3,923,487 F286L possibly damaging Het
Tg T C 15: 66,688,863 S10P probably benign Het
Tmprss7 C T 16: 45,680,733 R235Q probably benign Het
Tns3 G T 11: 8,451,146 L1051M probably benign Het
Tns3 T G 11: 8,479,518 E806A probably benign Het
Tns3 G A 11: 8,549,100 probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Txnrd2 A G 16: 18,475,565 H436R probably damaging Het
Ubr4 C T 4: 139,451,781 P2001S probably damaging Het
Vmn2r23 T A 6: 123,713,161 M332K probably benign Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zfyve21 A G 12: 111,827,633 D206G probably damaging Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Ahdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Ahdc1 APN 4 133063062 missense probably benign 0.33
IGL02293:Ahdc1 APN 4 133065618 missense possibly damaging 0.85
IGL02338:Ahdc1 APN 4 133062549 missense possibly damaging 0.73
IGL02828:Ahdc1 APN 4 133062921 missense possibly damaging 0.96
IGL02859:Ahdc1 APN 4 133062692 missense possibly damaging 0.53
IGL02859:Ahdc1 APN 4 133062693 missense probably damaging 0.99
IGL02901:Ahdc1 APN 4 133064934 missense possibly damaging 0.85
IGL03323:Ahdc1 APN 4 133065428 missense probably benign
FR4304:Ahdc1 UTSW 4 133062759 small insertion probably benign
FR4548:Ahdc1 UTSW 4 133062757 small insertion probably benign
FR4548:Ahdc1 UTSW 4 133062760 small insertion probably benign
FR4737:Ahdc1 UTSW 4 133062759 small insertion probably benign
R0325:Ahdc1 UTSW 4 133062719 missense unknown
R0550:Ahdc1 UTSW 4 133063037 missense probably benign 0.33
R0681:Ahdc1 UTSW 4 133065516 missense possibly damaging 0.53
R0683:Ahdc1 UTSW 4 133065516 missense possibly damaging 0.53
R0731:Ahdc1 UTSW 4 133062951 missense possibly damaging 0.86
R0751:Ahdc1 UTSW 4 133065396 missense probably benign 0.02
R1137:Ahdc1 UTSW 4 133062113 missense possibly damaging 0.68
R1184:Ahdc1 UTSW 4 133065396 missense probably benign 0.02
R1331:Ahdc1 UTSW 4 133063691 missense probably benign 0.18
R1599:Ahdc1 UTSW 4 133064936 missense possibly damaging 0.91
R2202:Ahdc1 UTSW 4 133065909 missense possibly damaging 0.72
R2205:Ahdc1 UTSW 4 133065909 missense possibly damaging 0.72
R2261:Ahdc1 UTSW 4 133063163 missense unknown
R2262:Ahdc1 UTSW 4 133063163 missense unknown
R3683:Ahdc1 UTSW 4 133065702 missense possibly damaging 0.96
R3684:Ahdc1 UTSW 4 133065702 missense possibly damaging 0.96
R3685:Ahdc1 UTSW 4 133065702 missense possibly damaging 0.96
R3713:Ahdc1 UTSW 4 133065986 missense possibly damaging 0.85
R4027:Ahdc1 UTSW 4 133064165 missense possibly damaging 0.73
R4807:Ahdc1 UTSW 4 133064313 missense possibly damaging 0.86
R4987:Ahdc1 UTSW 4 133064320 missense possibly damaging 0.53
R5126:Ahdc1 UTSW 4 133063522 missense probably benign 0.18
R5276:Ahdc1 UTSW 4 133062798 missense possibly damaging 0.93
R5680:Ahdc1 UTSW 4 133065596 missense probably benign
R5997:Ahdc1 UTSW 4 133063895 missense probably benign 0.05
R6050:Ahdc1 UTSW 4 133065891 missense possibly damaging 0.85
R6271:Ahdc1 UTSW 4 133064724 missense possibly damaging 0.73
R6410:Ahdc1 UTSW 4 133062899 missense probably damaging 0.97
R6519:Ahdc1 UTSW 4 133064768 missense possibly damaging 0.86
R6970:Ahdc1 UTSW 4 133062345 missense possibly damaging 0.96
R7199:Ahdc1 UTSW 4 133064624 missense probably benign 0.33
R7202:Ahdc1 UTSW 4 133061887 nonsense probably null
R7576:Ahdc1 UTSW 4 133065002 missense possibly damaging 0.91
R7614:Ahdc1 UTSW 4 133063514 missense probably benign 0.18
R7794:Ahdc1 UTSW 4 133063978 missense possibly damaging 0.70
R7875:Ahdc1 UTSW 4 133063850 missense possibly damaging 0.53
R8016:Ahdc1 UTSW 4 133062915 missense possibly damaging 0.96
R8295:Ahdc1 UTSW 4 133061451 start codon destroyed probably null 0.53
R8332:Ahdc1 UTSW 4 133063971 missense possibly damaging 0.85
R8719:Ahdc1 UTSW 4 133064222 missense possibly damaging 0.86
R8725:Ahdc1 UTSW 4 133065432 missense possibly damaging 0.86
R8862:Ahdc1 UTSW 4 133063818 missense possibly damaging 0.53
RF017:Ahdc1 UTSW 4 133062751 small insertion probably benign
RF020:Ahdc1 UTSW 4 133064277 missense possibly damaging 0.96
T0722:Ahdc1 UTSW 4 133062754 small insertion probably benign
Predicted Primers
Posted On2015-02-04