Incidental Mutation 'T0975:Inpp5j'
List |< first << previous [record 32 of 68] next >> last >|
ID262164
Institutional Source Beutler Lab
Gene Symbol Inpp5j
Ensembl Gene ENSMUSG00000034570
Gene Nameinositol polyphosphate 5-phosphatase J
SynonymsPipp, Pib5pa
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #T0975 (G3) of strain 714
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location3494375-3504821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 3502527 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 241 (T241N)
Ref Sequence ENSEMBL: ENSMUSP00000139302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044507] [ENSMUST00000044682] [ENSMUST00000110018] [ENSMUST00000110019] [ENSMUST00000154756] [ENSMUST00000183684]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044507
AA Change: T241N

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046625
Gene: ENSMUSG00000034570
AA Change: T241N

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 115 131 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 180 216 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 333 365 N/A INTRINSIC
low complexity region 390 413 N/A INTRINSIC
IPPc 418 733 4.41e-98 SMART
low complexity region 840 862 N/A INTRINSIC
low complexity region 868 887 N/A INTRINSIC
low complexity region 898 919 N/A INTRINSIC
low complexity region 924 943 N/A INTRINSIC
low complexity region 992 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000044682
SMART Domains Protein: ENSMUSP00000041571
Gene: ENSMUSG00000034579

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PA2c 139 259 1.58e-2 SMART
low complexity region 305 324 N/A INTRINSIC
Pfam:Phospholip_A2_2 343 431 4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110018
SMART Domains Protein: ENSMUSP00000105645
Gene: ENSMUSG00000034570

DomainStartEndE-ValueType
IPPc 2 301 4e-86 SMART
low complexity region 408 430 N/A INTRINSIC
low complexity region 436 455 N/A INTRINSIC
low complexity region 466 487 N/A INTRINSIC
low complexity region 492 511 N/A INTRINSIC
low complexity region 560 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110019
SMART Domains Protein: ENSMUSP00000105646
Gene: ENSMUSG00000034570

DomainStartEndE-ValueType
IPPc 2 301 4e-86 SMART
low complexity region 408 430 N/A INTRINSIC
low complexity region 436 455 N/A INTRINSIC
low complexity region 466 487 N/A INTRINSIC
low complexity region 492 511 N/A INTRINSIC
low complexity region 560 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148939
Predicted Effect possibly damaging
Transcript: ENSMUST00000154756
AA Change: T241N

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139302
Gene: ENSMUSG00000034570
AA Change: T241N

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 115 131 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 180 216 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 333 365 N/A INTRINSIC
low complexity region 390 413 N/A INTRINSIC
IPPc 418 733 4.41e-98 SMART
low complexity region 870 880 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183684
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable, fertile, and show normal mammary gland development and no spontaneous mammary tumors. However, in an oncogene-driven breast cancer mouse model, mice show increased mammary hyperplasia and tumor growth paradoxically associated with reduced lung metastases. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik TAA TAAA 11: 3,937,945 probably null Het
4930556J24Rik C T 11: 3,976,324 A27T unknown Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bpifb5 C A 2: 154,229,464 probably null Het
Ccdc157 C T 11: 4,146,246 A455T probably damaging Het
Ccng1 A C 11: 40,754,044 S9A probably benign Het
Cfh T C 1: 140,154,598 T164A probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Chrng T C 1: 87,210,626 S380P probably benign Het
Clspn ACGGCGGCGGCGGCG ACGGCGGCGGCGGCGGCGGCG 4: 126,566,437 probably benign Het
Ctrc T TA 4: 141,845,196 probably null Het
Cxxc1 C T 18: 74,220,921 R593C probably damaging Het
Dlgap1 T C 17: 70,516,955 S312P possibly damaging Het
Dnah10 A G 5: 124,763,066 S1255G probably benign Het
Dpep1 A T 8: 123,200,988 S388C probably damaging Het
Emid1 A C 11: 5,128,884 L353V probably benign Het
Emid1 T C 11: 5,144,386 T42A probably damaging Het
Epn3 A G 11: 94,491,907 probably null Het
Fam124b T C 1: 80,213,126 E180G probably benign Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Gatsl3 G C 11: 4,220,445 G147A probably benign Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm7534 GTG GTGCTG 4: 134,202,629 probably benign Het
Gm9972 GA GAA 11: 43,036,770 probably null Het
Hmmr G C 11: 40,723,416 N148K probably damaging Het
Homez C T 14: 54,857,339 R304K possibly damaging Het
Ifngr1 G A 10: 19,609,473 V407M probably damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kremen1 C T 11: 5,195,105 A424T probably benign Het
Mat2b G A 11: 40,680,091 T302I probably benign Het
Mtmr3 C T 11: 4,488,441 R671K probably benign Het
Nacad GCAGGGTCAGGGTC GCAGGGTCAGGGTCAGGGTC 11: 6,599,750 probably benign Het
Nacad T C 11: 6,601,622 N523S probably benign Het
Nacad A G 11: 6,601,632 C520R probably benign Het
Nefh G A 11: 4,940,151 P823S probably benign Het
Nfrkb G C 9: 31,397,083 A230P probably benign Het
Nlrp4a A G 7: 26,449,637 E223G probably damaging Het
Notch3 T A 17: 32,146,417 Y1107F probably damaging Het
Olfr1331 G T 4: 118,869,303 R174M probably benign Het
Olfr309 A T 7: 86,306,284 Y276* probably null Het
Olfr781 A G 10: 129,333,445 D188G probably benign Het
Osm A G 11: 4,239,588 D124G probably benign Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Sytl1 TCTGC TC 4: 133,256,994 probably benign Het
Tcn2 G C 11: 3,923,487 F286L possibly damaging Het
Tg T C 15: 66,688,863 S10P probably benign Het
Tmprss7 C T 16: 45,680,733 R235Q probably benign Het
Tns3 G T 11: 8,451,146 L1051M probably benign Het
Tns3 T G 11: 8,479,518 E806A probably benign Het
Tns3 G A 11: 8,549,100 probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Txnrd2 A G 16: 18,475,565 H436R probably damaging Het
Ubr4 C T 4: 139,451,781 P2001S probably damaging Het
Vmn2r23 T A 6: 123,713,161 M332K probably benign Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zfyve21 A G 12: 111,827,633 D206G probably damaging Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Inpp5j
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Inpp5j APN 11 3500009 splice site probably benign
IGL00435:Inpp5j APN 11 3502255 missense probably benign 0.00
IGL00509:Inpp5j APN 11 3501595 missense possibly damaging 0.94
IGL00916:Inpp5j APN 11 3502389 missense probably damaging 1.00
IGL00975:Inpp5j APN 11 3502176 missense probably damaging 1.00
IGL01523:Inpp5j APN 11 3495932 unclassified probably null
IGL02472:Inpp5j APN 11 3495338 unclassified probably benign
IGL02512:Inpp5j APN 11 3499661 missense probably damaging 1.00
IGL02897:Inpp5j APN 11 3500619 missense probably damaging 1.00
IGL03408:Inpp5j APN 11 3502809 missense possibly damaging 0.95
R0048:Inpp5j UTSW 11 3501417 missense probably damaging 0.97
R0440:Inpp5j UTSW 11 3501150 missense possibly damaging 0.95
R0455:Inpp5j UTSW 11 3503122 missense possibly damaging 0.66
R0483:Inpp5j UTSW 11 3499738 missense probably damaging 1.00
R0554:Inpp5j UTSW 11 3499644 missense probably damaging 1.00
R0639:Inpp5j UTSW 11 3501147 missense probably benign 0.29
R0673:Inpp5j UTSW 11 3501147 missense probably benign 0.29
R0926:Inpp5j UTSW 11 3501439 splice site probably benign
R1114:Inpp5j UTSW 11 3494814 missense possibly damaging 0.57
R1132:Inpp5j UTSW 11 3502305 missense possibly damaging 0.90
R1463:Inpp5j UTSW 11 3501147 missense probably benign 0.03
R1757:Inpp5j UTSW 11 3504738 missense possibly damaging 0.49
R1978:Inpp5j UTSW 11 3502150 missense probably damaging 1.00
R3078:Inpp5j UTSW 11 3503124 unclassified probably null
R3831:Inpp5j UTSW 11 3500229 missense probably damaging 1.00
R4012:Inpp5j UTSW 11 3500185 missense probably benign 0.06
R4183:Inpp5j UTSW 11 3501134 missense probably damaging 0.99
R4209:Inpp5j UTSW 11 3501107 missense probably damaging 1.00
R4210:Inpp5j UTSW 11 3501107 missense probably damaging 1.00
R4211:Inpp5j UTSW 11 3501107 missense probably damaging 1.00
R4477:Inpp5j UTSW 11 3501625 missense probably damaging 1.00
R4729:Inpp5j UTSW 11 3495025 missense probably damaging 0.99
R4840:Inpp5j UTSW 11 3499676 missense probably damaging 1.00
R5025:Inpp5j UTSW 11 3500664 missense probably damaging 1.00
R5151:Inpp5j UTSW 11 3502270 missense probably damaging 1.00
R5195:Inpp5j UTSW 11 3499889 critical splice donor site probably null
R5623:Inpp5j UTSW 11 3494766 missense probably damaging 0.96
R6262:Inpp5j UTSW 11 3502615 missense probably benign 0.02
R6448:Inpp5j UTSW 11 3495387 missense probably damaging 0.99
R6465:Inpp5j UTSW 11 3502293 missense possibly damaging 0.84
R6723:Inpp5j UTSW 11 3500640 missense probably damaging 0.99
R6895:Inpp5j UTSW 11 3495557 splice site probably null
R7060:Inpp5j UTSW 11 3500133 splice site probably null
R7346:Inpp5j UTSW 11 3501065 missense probably damaging 1.00
R8026:Inpp5j UTSW 11 3495171 missense
Z1176:Inpp5j UTSW 11 3502484 nonsense probably null
Z1177:Inpp5j UTSW 11 3502191 missense probably damaging 1.00
Predicted Primers
Posted On2015-02-04