Incidental Mutation 'T0975:Tcn2'
ID262165
Institutional Source Beutler Lab
Gene Symbol Tcn2
Ensembl Gene ENSMUSG00000020432
Gene Nametranscobalamin 2
SynonymsTcn-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #T0975 (G3) of strain 714
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location3917192-3932159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 3923487 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 286 (F286L)
Ref Sequence ENSEMBL: ENSMUSP00000105620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020710] [ENSMUST00000109988] [ENSMUST00000109989] [ENSMUST00000109990] [ENSMUST00000109991] [ENSMUST00000109992] [ENSMUST00000109993]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020710
AA Change: F286L

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020710
Gene: ENSMUSG00000020432
AA Change: F286L

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109988
AA Change: F286L

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105615
Gene: ENSMUSG00000020432
AA Change: F286L

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109989
AA Change: F286L

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105616
Gene: ENSMUSG00000020432
AA Change: F286L

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109990
AA Change: F286L

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105617
Gene: ENSMUSG00000020432
AA Change: F286L

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109991
AA Change: F286L

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105618
Gene: ENSMUSG00000020432
AA Change: F286L

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 3 331 1.2e-118 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 429 9.3e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109992
AA Change: F286L

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105619
Gene: ENSMUSG00000020432
AA Change: F286L

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109993
AA Change: F286L

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105620
Gene: ENSMUSG00000020432
AA Change: F286L

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vitamin B12-binding protein family. This family of proteins, alternatively referred to as R binders, is expressed in various tissues and secretions. This plasma protein binds cobalamin and mediates the transport of cobalamin into cells. This protein and other mammalian cobalamin-binding proteins, such as transcobalamin I and gastric intrisic factor, may have evolved by duplication of a common ancestral gene. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: This locus controls transcobalamin-2 electrophoretic variation. The s allele determines a slow band in serum from A/J, C57BL/6, BALB/c and C3H/He; the f allele determines faster form in NZB, ST/b and CPB-WV. Heterozygotes have both forms. Sequencing reveals a Gly to Glu substitution in NZB compared to BALB/c, DBA/2 and C57BL/6 (Genbank AF090686). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,976,324 A27T unknown Het
4930556J24Rik TAA TAAA 11: 3,937,945 probably null Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bpifb5 C A 2: 154,229,464 probably null Het
Ccdc157 C T 11: 4,146,246 A455T probably damaging Het
Ccng1 A C 11: 40,754,044 S9A probably benign Het
Cfh T C 1: 140,154,598 T164A probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Chrng T C 1: 87,210,626 S380P probably benign Het
Clspn ACGGCGGCGGCGGCG ACGGCGGCGGCGGCGGCGGCG 4: 126,566,437 probably benign Het
Ctrc T TA 4: 141,845,196 probably null Het
Cxxc1 C T 18: 74,220,921 R593C probably damaging Het
Dlgap1 T C 17: 70,516,955 S312P possibly damaging Het
Dnah10 A G 5: 124,763,066 S1255G probably benign Het
Dpep1 A T 8: 123,200,988 S388C probably damaging Het
Emid1 T C 11: 5,144,386 T42A probably damaging Het
Emid1 A C 11: 5,128,884 L353V probably benign Het
Epn3 A G 11: 94,491,907 probably null Het
Fam124b T C 1: 80,213,126 E180G probably benign Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Gatsl3 G C 11: 4,220,445 G147A probably benign Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm7534 GTG GTGCTG 4: 134,202,629 probably benign Het
Gm9972 GA GAA 11: 43,036,770 probably null Het
Hmmr G C 11: 40,723,416 N148K probably damaging Het
Homez C T 14: 54,857,339 R304K possibly damaging Het
Ifngr1 G A 10: 19,609,473 V407M probably damaging Het
Inpp5j G T 11: 3,502,527 T241N possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kremen1 C T 11: 5,195,105 A424T probably benign Het
Mat2b G A 11: 40,680,091 T302I probably benign Het
Mtmr3 C T 11: 4,488,441 R671K probably benign Het
Nacad GCAGGGTCAGGGTC GCAGGGTCAGGGTCAGGGTC 11: 6,599,750 probably benign Het
Nacad T C 11: 6,601,622 N523S probably benign Het
Nacad A G 11: 6,601,632 C520R probably benign Het
Nefh G A 11: 4,940,151 P823S probably benign Het
Nfrkb G C 9: 31,397,083 A230P probably benign Het
Nlrp4a A G 7: 26,449,637 E223G probably damaging Het
Notch3 T A 17: 32,146,417 Y1107F probably damaging Het
Olfr1331 G T 4: 118,869,303 R174M probably benign Het
Olfr309 A T 7: 86,306,284 Y276* probably null Het
Olfr781 A G 10: 129,333,445 D188G probably benign Het
Osm A G 11: 4,239,588 D124G probably benign Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Sytl1 TCTGC TC 4: 133,256,994 probably benign Het
Tg T C 15: 66,688,863 S10P probably benign Het
Tmprss7 C T 16: 45,680,733 R235Q probably benign Het
Tns3 G T 11: 8,451,146 L1051M probably benign Het
Tns3 T G 11: 8,479,518 E806A probably benign Het
Tns3 G A 11: 8,549,100 probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Txnrd2 A G 16: 18,475,565 H436R probably damaging Het
Ubr4 C T 4: 139,451,781 P2001S probably damaging Het
Vmn2r23 T A 6: 123,713,161 M332K probably benign Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zfyve21 A G 12: 111,827,633 D206G probably damaging Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Tcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01962:Tcn2 APN 11 3925072 missense probably benign
IGL02311:Tcn2 APN 11 3917692 missense probably damaging 1.00
IGL02614:Tcn2 APN 11 3926158 missense possibly damaging 0.91
IGL02655:Tcn2 APN 11 3926158 missense possibly damaging 0.91
IGL02679:Tcn2 APN 11 3927504 missense possibly damaging 0.93
IGL02752:Tcn2 APN 11 3926158 missense possibly damaging 0.91
R0265:Tcn2 UTSW 11 3922044 missense probably damaging 1.00
R0845:Tcn2 UTSW 11 3919349 missense probably benign
R1255:Tcn2 UTSW 11 3922120 missense probably benign 0.16
R1459:Tcn2 UTSW 11 3927516 missense probably benign 0.01
R1696:Tcn2 UTSW 11 3922169 missense probably damaging 1.00
R4209:Tcn2 UTSW 11 3922114 missense possibly damaging 0.91
R4210:Tcn2 UTSW 11 3922114 missense possibly damaging 0.91
R4211:Tcn2 UTSW 11 3922114 missense possibly damaging 0.91
R5357:Tcn2 UTSW 11 3926017 missense possibly damaging 0.91
R5973:Tcn2 UTSW 11 3927546 nonsense probably null
R6973:Tcn2 UTSW 11 3917649 makesense probably null
R7479:Tcn2 UTSW 11 3917703 missense probably damaging 1.00
R8023:Tcn2 UTSW 11 3927579 missense possibly damaging 0.95
R8854:Tcn2 UTSW 11 3926074 missense possibly damaging 0.90
Predicted Primers
Posted On2015-02-04