Incidental Mutation 'T0975:Mtmr3'
Institutional Source Beutler Lab
Gene Symbol Mtmr3
Ensembl Gene ENSMUSG00000034354
Gene Namemyotubularin related protein 3
SynonymsFYVE-DSP1, 1700092A20Rik, ZFYVE10
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #T0975 (G3) of strain 714
Quality Score169
Status Not validated
Chromosomal Location4480868-4594863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4488441 bp
Amino Acid Change Arginine to Lysine at position 671 (R671K)
Ref Sequence ENSEMBL: ENSMUSP00000137687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040448] [ENSMUST00000109943] [ENSMUST00000123506] [ENSMUST00000128256] [ENSMUST00000130716]
Predicted Effect probably benign
Transcript: ENSMUST00000040448
AA Change: R671K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049079
Gene: ENSMUSG00000034354
AA Change: R671K

Pfam:Myotub-related 126 527 7.6e-149 PFAM
low complexity region 578 590 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
coiled coil region 1027 1058 N/A INTRINSIC
FYVE 1072 1141 3.63e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109943
AA Change: R671K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105569
Gene: ENSMUSG00000034354
AA Change: R671K

Pfam:Myotub-related 126 527 7.6e-149 PFAM
low complexity region 578 590 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
coiled coil region 1027 1058 N/A INTRINSIC
FYVE 1072 1141 3.63e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123506
AA Change: R670K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122422
Gene: ENSMUSG00000034354
AA Change: R670K

Pfam:Myotub-related 126 524 1e-138 PFAM
low complexity region 577 589 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
coiled coil region 1026 1057 N/A INTRINSIC
FYVE 1108 1177 7.77e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128256
AA Change: R670K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116315
Gene: ENSMUSG00000034354
AA Change: R670K

Pfam:Myotub-related 125 526 7.7e-149 PFAM
low complexity region 577 589 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
coiled coil region 1026 1057 N/A INTRINSIC
FYVE 1071 1149 1.42e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130716
AA Change: R671K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137687
Gene: ENSMUSG00000034354
AA Change: R671K

Pfam:Myotub-related 126 527 2.2e-148 PFAM
low complexity region 578 590 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
coiled coil region 1027 1058 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155566
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myotubularin dual specificity protein phosphatase gene family. The encoded protein is structurally similar to myotubularin but in addition contains a FYVE domain and an N-terminal PH-GRAM domain. The protein can self-associate and also form heteromers with another myotubularin related protein. The protein binds to phosphoinositide lipids through the PH-GRAM domain, and can hydrolyze phosphatidylinositol(3)-phosphate and phosphatidylinositol(3,5)-biphosphate in vitro. The encoded protein has been observed to have a perinuclear, possibly membrane-bound, distribution in cells, but it has also been found free in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased serum alkaline phosphatase level and, in males, impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,976,324 A27T unknown Het
4930556J24Rik TAA TAAA 11: 3,937,945 probably null Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bpifb5 C A 2: 154,229,464 probably null Het
Ccdc157 C T 11: 4,146,246 A455T probably damaging Het
Ccng1 A C 11: 40,754,044 S9A probably benign Het
Cfh T C 1: 140,154,598 T164A probably benign Het
Chrng T C 1: 87,210,626 S380P probably benign Het
Clspn ACGGCGGCGGCGGCG ACGGCGGCGGCGGCGGCGGCG 4: 126,566,437 probably benign Het
Ctrc T TA 4: 141,845,196 probably null Het
Cxxc1 C T 18: 74,220,921 R593C probably damaging Het
Dlgap1 T C 17: 70,516,955 S312P possibly damaging Het
Dnah10 A G 5: 124,763,066 S1255G probably benign Het
Dpep1 A T 8: 123,200,988 S388C probably damaging Het
Emid1 T C 11: 5,144,386 T42A probably damaging Het
Emid1 A C 11: 5,128,884 L353V probably benign Het
Epn3 A G 11: 94,491,907 probably null Het
Fam124b T C 1: 80,213,126 E180G probably benign Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Gatsl3 G C 11: 4,220,445 G147A probably benign Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm7534 GTG GTGCTG 4: 134,202,629 probably benign Het
Gm9972 GA GAA 11: 43,036,770 probably null Het
Hmmr G C 11: 40,723,416 N148K probably damaging Het
Homez C T 14: 54,857,339 R304K possibly damaging Het
Ifngr1 G A 10: 19,609,473 V407M probably damaging Het
Inpp5j G T 11: 3,502,527 T241N possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kremen1 C T 11: 5,195,105 A424T probably benign Het
Mat2b G A 11: 40,680,091 T302I probably benign Het
Nacad GCAGGGTCAGGGTC GCAGGGTCAGGGTCAGGGTC 11: 6,599,750 probably benign Het
Nacad T C 11: 6,601,622 N523S probably benign Het
Nacad A G 11: 6,601,632 C520R probably benign Het
Nefh G A 11: 4,940,151 P823S probably benign Het
Nfrkb G C 9: 31,397,083 A230P probably benign Het
Nlrp4a A G 7: 26,449,637 E223G probably damaging Het
Notch3 T A 17: 32,146,417 Y1107F probably damaging Het
Olfr1331 G T 4: 118,869,303 R174M probably benign Het
Olfr309 A T 7: 86,306,284 Y276* probably null Het
Olfr781 A G 10: 129,333,445 D188G probably benign Het
Osm A G 11: 4,239,588 D124G probably benign Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Sytl1 TCTGC TC 4: 133,256,994 probably benign Het
Tcn2 G C 11: 3,923,487 F286L possibly damaging Het
Tg T C 15: 66,688,863 S10P probably benign Het
Tmprss7 C T 16: 45,680,733 R235Q probably benign Het
Tns3 G T 11: 8,451,146 L1051M probably benign Het
Tns3 T G 11: 8,479,518 E806A probably benign Het
Tns3 G A 11: 8,549,100 probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Txnrd2 A G 16: 18,475,565 H436R probably damaging Het
Ubr4 C T 4: 139,451,781 P2001S probably damaging Het
Vmn2r23 T A 6: 123,713,161 M332K probably benign Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zfyve21 A G 12: 111,827,633 D206G probably damaging Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Mtmr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Mtmr3 APN 11 4527861 missense probably damaging 1.00
IGL01808:Mtmr3 APN 11 4497404 missense probably damaging 1.00
IGL01994:Mtmr3 APN 11 4487938 missense probably benign
IGL02839:Mtmr3 APN 11 4487994 missense probably benign 0.03
IGL02893:Mtmr3 APN 11 4507632 missense possibly damaging 0.89
IGL03370:Mtmr3 APN 11 4487385 missense probably damaging 1.00
capellini UTSW 11 4497381 nonsense probably null
R0322:Mtmr3 UTSW 11 4487505 missense possibly damaging 0.59
R0363:Mtmr3 UTSW 11 4487536 missense probably damaging 0.99
R0655:Mtmr3 UTSW 11 4488610 missense probably damaging 1.00
R0866:Mtmr3 UTSW 11 4488474 missense probably benign 0.03
R1065:Mtmr3 UTSW 11 4492859 missense probably damaging 1.00
R1417:Mtmr3 UTSW 11 4487923 missense probably benign
R1698:Mtmr3 UTSW 11 4492825 missense possibly damaging 0.95
R1707:Mtmr3 UTSW 11 4504095 missense probably damaging 1.00
R2191:Mtmr3 UTSW 11 4499032 missense probably damaging 1.00
R2192:Mtmr3 UTSW 11 4499032 missense probably damaging 1.00
R3956:Mtmr3 UTSW 11 4491138 missense probably damaging 1.00
R4079:Mtmr3 UTSW 11 4491057 missense probably damaging 1.00
R4320:Mtmr3 UTSW 11 4487947 missense probably benign 0.39
R4577:Mtmr3 UTSW 11 4497375 missense probably damaging 1.00
R4622:Mtmr3 UTSW 11 4491067 missense possibly damaging 0.62
R4676:Mtmr3 UTSW 11 4527855 missense probably benign 0.12
R4726:Mtmr3 UTSW 11 4507634 missense probably damaging 1.00
R4781:Mtmr3 UTSW 11 4488435 missense probably benign 0.00
R4799:Mtmr3 UTSW 11 4487764 missense probably benign 0.12
R4810:Mtmr3 UTSW 11 4498046 missense probably benign 0.33
R5744:Mtmr3 UTSW 11 4487679 missense possibly damaging 0.47
R5847:Mtmr3 UTSW 11 4482925 missense probably damaging 1.00
R5933:Mtmr3 UTSW 11 4498951 missense probably benign
R6102:Mtmr3 UTSW 11 4487673 missense probably damaging 0.99
R6105:Mtmr3 UTSW 11 4485432 missense probably damaging 0.99
R6254:Mtmr3 UTSW 11 4497381 nonsense probably null
R6443:Mtmr3 UTSW 11 4487358 missense probably damaging 0.99
R6881:Mtmr3 UTSW 11 4489725 missense probably benign 0.33
R6941:Mtmr3 UTSW 11 4487505 missense possibly damaging 0.59
R6986:Mtmr3 UTSW 11 4489692 missense probably damaging 1.00
R7045:Mtmr3 UTSW 11 4498896 missense possibly damaging 0.94
R8469:Mtmr3 UTSW 11 4531223 start codon destroyed probably null 0.95
Z1176:Mtmr3 UTSW 11 4485913 missense probably damaging 1.00
Predicted Primers
Posted On2015-02-04