Incidental Mutation 'T0975:Mat2b'
List |< first << previous [record 35 of 68] next >> last >|
ID262190
Institutional Source Beutler Lab
Gene Symbol Mat2b
Ensembl Gene ENSMUSG00000042032
Gene Namemethionine adenosyltransferase II, beta
Synonyms2410018D16Rik, 1110064C04Rik, MATIIbeta
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #T0975 (G3) of strain 714
Quality Score190
Status Not validated
Chromosome11
Chromosomal Location40679314-40695203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40680091 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 302 (T302I)
Ref Sequence ENSEMBL: ENSMUSP00000098901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040167] [ENSMUST00000101347] [ENSMUST00000141830]
Predicted Effect probably benign
Transcript: ENSMUST00000040167
AA Change: T313I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048222
Gene: ENSMUSG00000042032
AA Change: T313I

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 29 324 9.1e-90 PFAM
Pfam:Epimerase 31 244 5.7e-25 PFAM
Pfam:GDP_Man_Dehyd 32 317 2.3e-11 PFAM
Pfam:Polysacc_synt_2 59 209 3.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101347
AA Change: T302I

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000098901
Gene: ENSMUSG00000042032
AA Change: T302I

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:RmlD_sub_bind 18 313 4.6e-86 PFAM
Pfam:NAD_binding_10 20 226 8.7e-12 PFAM
Pfam:Epimerase 20 236 1.1e-26 PFAM
Pfam:Polysacc_synt_2 49 222 4.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137797
Predicted Effect probably benign
Transcript: ENSMUST00000141830
SMART Domains Protein: ENSMUSP00000123878
Gene: ENSMUSG00000042032

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 29 91 4e-9 PFAM
Pfam:Epimerase 31 96 4.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156867
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the methionine adenosyltransferase (MAT) family. MAT catalyzes the biosynthesis of S-adenosylmethionine from methionine and ATP. This protein is the regulatory beta subunit of MAT. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik TAA TAAA 11: 3,937,945 probably null Het
4930556J24Rik C T 11: 3,976,324 A27T unknown Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bpifb5 C A 2: 154,229,464 probably null Het
Ccdc157 C T 11: 4,146,246 A455T probably damaging Het
Ccng1 A C 11: 40,754,044 S9A probably benign Het
Cfh T C 1: 140,154,598 T164A probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Chrng T C 1: 87,210,626 S380P probably benign Het
Clspn ACGGCGGCGGCGGCG ACGGCGGCGGCGGCGGCGGCG 4: 126,566,437 probably benign Het
Ctrc T TA 4: 141,845,196 probably null Het
Cxxc1 C T 18: 74,220,921 R593C probably damaging Het
Dlgap1 T C 17: 70,516,955 S312P possibly damaging Het
Dnah10 A G 5: 124,763,066 S1255G probably benign Het
Dpep1 A T 8: 123,200,988 S388C probably damaging Het
Emid1 A C 11: 5,128,884 L353V probably benign Het
Emid1 T C 11: 5,144,386 T42A probably damaging Het
Epn3 A G 11: 94,491,907 probably null Het
Fam124b T C 1: 80,213,126 E180G probably benign Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Gatsl3 G C 11: 4,220,445 G147A probably benign Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm7534 GTG GTGCTG 4: 134,202,629 probably benign Het
Gm9972 GA GAA 11: 43,036,770 probably null Het
Hmmr G C 11: 40,723,416 N148K probably damaging Het
Homez C T 14: 54,857,339 R304K possibly damaging Het
Ifngr1 G A 10: 19,609,473 V407M probably damaging Het
Inpp5j G T 11: 3,502,527 T241N possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kremen1 C T 11: 5,195,105 A424T probably benign Het
Mtmr3 C T 11: 4,488,441 R671K probably benign Het
Nacad GCAGGGTCAGGGTC GCAGGGTCAGGGTCAGGGTC 11: 6,599,750 probably benign Het
Nacad T C 11: 6,601,622 N523S probably benign Het
Nacad A G 11: 6,601,632 C520R probably benign Het
Nefh G A 11: 4,940,151 P823S probably benign Het
Nfrkb G C 9: 31,397,083 A230P probably benign Het
Nlrp4a A G 7: 26,449,637 E223G probably damaging Het
Notch3 T A 17: 32,146,417 Y1107F probably damaging Het
Olfr1331 G T 4: 118,869,303 R174M probably benign Het
Olfr309 A T 7: 86,306,284 Y276* probably null Het
Olfr781 A G 10: 129,333,445 D188G probably benign Het
Osm A G 11: 4,239,588 D124G probably benign Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Sytl1 TCTGC TC 4: 133,256,994 probably benign Het
Tcn2 G C 11: 3,923,487 F286L possibly damaging Het
Tg T C 15: 66,688,863 S10P probably benign Het
Tmprss7 C T 16: 45,680,733 R235Q probably benign Het
Tns3 G T 11: 8,451,146 L1051M probably benign Het
Tns3 T G 11: 8,479,518 E806A probably benign Het
Tns3 G A 11: 8,549,100 probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Txnrd2 A G 16: 18,475,565 H436R probably damaging Het
Ubr4 C T 4: 139,451,781 P2001S probably damaging Het
Vmn2r23 T A 6: 123,713,161 M332K probably benign Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zfyve21 A G 12: 111,827,633 D206G probably damaging Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Mat2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Mat2b APN 11 40687738 missense probably damaging 1.00
IGL00509:Mat2b APN 11 40684727 missense possibly damaging 0.61
IGL02929:Mat2b APN 11 40684713 missense probably benign
R0525:Mat2b UTSW 11 40682669 splice site probably benign
R1733:Mat2b UTSW 11 40680077 missense probably benign 0.02
R5054:Mat2b UTSW 11 40680042 missense probably damaging 1.00
R5729:Mat2b UTSW 11 40682546 missense probably damaging 0.99
R6748:Mat2b UTSW 11 40680194 missense probably benign 0.24
R8076:Mat2b UTSW 11 40685265 missense probably damaging 1.00
Z1176:Mat2b UTSW 11 40682485 missense probably damaging 1.00
Z1176:Mat2b UTSW 11 40687777 missense probably benign
Predicted Primers
Posted On2015-02-04