Mutagenetix > Incidental Mutation

Incidental Mutation 'R0734:Aox2'

262201

Institutional Source

Beutler Lab

Gene Symbol

Aox2

Ensembl Gene

ENSMUSG00000079554

Gene Name

aldehyde oxidase 2

Synonyms

Aox3l1

MMRRC Submission

038915-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R0734 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

58278326-58380259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 58305341 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 531 (E531V)

Ref Sequence

ENSEMBL: ENSMUSP00000110006 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114366]

AlphaFold

Q5SGK3

Predicted Effect

probably benign
Transcript: ENSMUST00000114366
AA Change: E531V

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: E531V

Domain	Start	End	E-Value	Type
Pfam:Fer2	13	83	3.4e-9	PFAM
Pfam:Fer2_2	92	166	4.2e-30	PFAM
Pfam:FAD_binding_5	241	421	5.1e-46	PFAM
CO_deh_flav_C	428	532	1.4e-23	SMART
Ald_Xan_dh_C	604	707	4.64e-47	SMART
Pfam:Ald_Xan_dh_C2	717	1251	1.3e-178	PFAM
low complexity region	1257	1271	N/A	INTRINSIC
low complexity region	1285	1303	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161126

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 98.8%
10x: 97.0%
20x: 93.3%

Validation Efficiency

99% (80/81)

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	T	A	16: 4,850,334	S530T	probably benign	Het
Acer2	G	T	4: 86,917,559	K223N	probably benign	Het
Adam19	T	G	11: 46,127,403	C431G	probably damaging	Het
Adamts16	T	G	13: 70,738,481		probably benign	Het
Apaf1	A	T	10: 91,037,021	N720K	probably benign	Het
Atrnl1	T	A	19: 57,654,861	W394R	probably damaging	Het
Bcl6	T	C	16: 23,968,139	E634G	probably damaging	Het
Cfap65	T	A	1: 74,918,887	Y954F	probably damaging	Het
Cobl	A	G	11: 12,375,971	V168A	probably damaging	Het
Cped1	C	T	6: 22,085,041	P210S	probably damaging	Het
Crb1	C	T	1: 139,337,084	V199M	probably benign	Het
Cyp2j6	A	T	4: 96,523,844		probably benign	Het
Dhrs3	C	G	4: 144,927,176	S289W	probably damaging	Het
Dido1	T	G	2: 180,660,042	Q2023P	probably benign	Het
Dlg4	G	A	11: 70,042,705	G550R	probably damaging	Het
Dnah12	C	A	14: 26,800,013	H1928N	probably benign	Het
Dthd1	A	C	5: 62,839,410		probably benign	Het
Erg	C	A	16: 95,370,025	G269C	possibly damaging	Het
Erich6	G	A	3: 58,629,388		probably benign	Het
F5	G	C	1: 164,198,917	R1686P	probably damaging	Het
Fancc	T	C	13: 63,331,842	R300G	probably damaging	Het
Fcer1g	T	A	1: 171,231,179	K47*	probably null	Het
Flt4	A	G	11: 49,626,717	T289A	possibly damaging	Het
Gcnt2	T	A	13: 40,860,521	F56Y	probably benign	Het
Gpatch8	G	T	11: 102,481,400	S437R	unknown	Het
Grin2a	T	A	16: 9,579,611	I871F	possibly damaging	Het
Hsd17b4	T	C	18: 50,170,777	V439A	possibly damaging	Het
Hykk	A	T	9: 54,946,432	K346M	possibly damaging	Het
Ifi208	T	C	1: 173,683,335	L352S	probably damaging	Het
Ikzf1	T	C	11: 11,758,195	V110A	probably damaging	Het
Irak3	A	T	10: 120,145,637		probably benign	Het
Lamp5	T	A	2: 136,059,030	V50E	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrch3	C	T	16: 32,997,483	R570*	probably null	Het
Map1lc3a	T	C	2: 155,276,976	V20A	possibly damaging	Het
Map3k14	C	A	11: 103,227,000	K655N	probably benign	Het
Mark2	A	G	19: 7,285,981		probably benign	Het
Mbtd1	G	A	11: 93,923,146	G205D	probably damaging	Het
Med13	T	C	11: 86,301,237	T861A	probably benign	Het
Meltf	T	A	16: 31,881,958	Y99N	probably damaging	Het
Mex3d	G	A	10: 80,381,532	T617I	possibly damaging	Het
Muc13	G	A	16: 33,803,082	V249I	probably damaging	Het
Myo18a	C	A	11: 77,847,404	P1688Q	probably damaging	Het
Naaladl1	A	T	19: 6,112,874		probably null	Het
Ncoa3	T	A	2: 166,069,191		probably benign	Het
Nf2	T	C	11: 4,820,409	T67A	probably benign	Het
Nin	A	G	12: 70,030,113	V1056A	probably benign	Het
Olfr1426	T	A	19: 12,088,119	R224S	probably benign	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr59	A	T	11: 74,288,946	Q100L	probably damaging	Het
P3h1	T	C	4: 119,238,688	L331P	probably damaging	Het
Pabpc4l	T	C	3: 46,446,973	K79E	possibly damaging	Het
Pam	T	A	1: 97,864,362	R445*	probably null	Het
Pcdhb6	T	C	18: 37,335,334	I436T	probably damaging	Het
Piezo2	A	G	18: 63,041,723	Y1987H	probably damaging	Het
Plch2	G	A	4: 154,996,283	T477I	probably damaging	Het
Postn	G	A	3: 54,362,715	G72R	probably damaging	Het
Proca1	G	A	11: 78,201,802		probably benign	Het
Psip1	T	A	4: 83,463,588		probably benign	Het
Ptprd	G	A	4: 76,140,597	P153L	probably damaging	Het
Rgl1	T	C	1: 152,554,300	D242G	probably damaging	Het
Ric1	T	A	19: 29,594,818	I671K	possibly damaging	Het
Rxrg	T	A	1: 167,627,444	C199S	probably damaging	Het
Sec24c	A	C	14: 20,693,745	D1006A	probably damaging	Het
Sec63	A	G	10: 42,796,208	T173A	probably benign	Het
Sfxn5	T	C	6: 85,267,865		probably benign	Het
Spam1	A	G	6: 24,796,949	I300V	probably benign	Het
Spem1	A	G	11: 69,821,271	L189P	probably damaging	Het
Sptbn2	A	T	19: 4,748,123	R1959*	probably null	Het
Timeless	C	T	10: 128,250,060	R935W	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Trim24	T	C	6: 37,919,465	Y286H	possibly damaging	Het
Ttyh2	A	G	11: 114,710,193		probably benign	Het
Zbtb21	C	T	16: 97,952,627	C180Y	probably damaging	Het
Zfp746	T	C	6: 48,064,899	T298A	probably damaging	Het

Other mutations in Aox2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Aox2	APN	1	58322801	missense	possibly damaging	0.73
IGL01288:Aox2	APN	1	58294407	missense	probably damaging	0.99
IGL01383:Aox2	APN	1	58294305	missense	probably benign	0.09
IGL01734:Aox2	APN	1	58354310	missense	possibly damaging	0.95
IGL01793:Aox2	APN	1	58336624	missense	possibly damaging	0.79
IGL01834:Aox2	APN	1	58309024	missense	possibly damaging	0.90
IGL01924:Aox2	APN	1	58287743	missense	possibly damaging	0.90
IGL02591:Aox2	APN	1	58358999	nonsense	probably null
IGL02645:Aox2	APN	1	58334724	missense	probably damaging	1.00
IGL02710:Aox2	APN	1	58334769	critical splice donor site	probably null
IGL02801:Aox2	APN	1	58354177	missense	probably damaging	1.00
IGL02988:Aox2	APN	1	58337350	missense	probably benign
IGL03104:Aox2	APN	1	58282759	missense	probably benign
IGL03121:Aox2	APN	1	58358954	missense	probably damaging	1.00
IGL03191:Aox2	APN	1	58359069	missense	probably null	0.98
IGL03236:Aox2	APN	1	58309997	nonsense	probably null
IGL03409:Aox2	APN	1	58354429	missense	possibly damaging	0.91
PIT4362001:Aox2	UTSW	1	58282680	missense	probably damaging	1.00
R0035:Aox2	UTSW	1	58354422	missense	probably benign	0.00
R0035:Aox2	UTSW	1	58354422	missense	probably benign	0.00
R0267:Aox2	UTSW	1	58339446	splice site	probably benign
R0388:Aox2	UTSW	1	58354406	missense	probably damaging	1.00
R0409:Aox2	UTSW	1	58336624	missense	possibly damaging	0.90
R0547:Aox2	UTSW	1	58310042	missense	probably damaging	0.96
R0630:Aox2	UTSW	1	58337321	splice site	probably benign
R0726:Aox2	UTSW	1	58334782	splice site	probably benign
R0831:Aox2	UTSW	1	58339683	missense	probably benign	0.28
R0961:Aox2	UTSW	1	58310071	missense	probably benign	0.00
R1404:Aox2	UTSW	1	58346212	splice site	probably benign
R1512:Aox2	UTSW	1	58307351	missense	probably benign	0.00
R1573:Aox2	UTSW	1	58309027	missense	probably benign	0.00
R1592:Aox2	UTSW	1	58300694	missense	probably benign	0.00
R1747:Aox2	UTSW	1	58339592	missense	probably benign	0.01
R1768:Aox2	UTSW	1	58354195	missense	probably benign	0.00
R1809:Aox2	UTSW	1	58294325	missense	probably benign
R1823:Aox2	UTSW	1	58312359	missense	probably benign	0.02
R1834:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R1835:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R1836:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R2219:Aox2	UTSW	1	58349130	splice site	probably null
R2220:Aox2	UTSW	1	58349130	splice site	probably null
R2508:Aox2	UTSW	1	58343673	missense	probably benign	0.38
R2942:Aox2	UTSW	1	58337381	missense	probably benign	0.03
R2967:Aox2	UTSW	1	58322834	missense	probably damaging	0.96
R3082:Aox2	UTSW	1	58283600	splice site	probably benign
R3161:Aox2	UTSW	1	58304438	missense	possibly damaging	0.91
R3408:Aox2	UTSW	1	58343668	missense	probably benign	0.32
R3803:Aox2	UTSW	1	58289899	splice site	probably null
R3894:Aox2	UTSW	1	58334678	critical splice acceptor site	probably null
R4214:Aox2	UTSW	1	58307444	critical splice donor site	probably null
R4249:Aox2	UTSW	1	58299819	missense	probably benign	0.01
R4666:Aox2	UTSW	1	58304597	nonsense	probably null
R4668:Aox2	UTSW	1	58334694	missense	possibly damaging	0.63
R4703:Aox2	UTSW	1	58358957	missense	possibly damaging	0.78
R4758:Aox2	UTSW	1	58332582	missense	probably benign	0.00
R4890:Aox2	UTSW	1	58334703	missense	probably benign	0.11
R4900:Aox2	UTSW	1	58305385	missense	probably benign
R4924:Aox2	UTSW	1	58305344	missense	probably damaging	1.00
R4970:Aox2	UTSW	1	58310095	splice site	probably null
R5112:Aox2	UTSW	1	58310095	splice site	probably null
R5987:Aox2	UTSW	1	58307359	missense	probably benign	0.00
R6239:Aox2	UTSW	1	58305391	critical splice donor site	probably null
R6273:Aox2	UTSW	1	58339672	missense	probably benign	0.00
R6291:Aox2	UTSW	1	58330806	missense	probably damaging	0.98
R6334:Aox2	UTSW	1	58307407	nonsense	probably null
R6764:Aox2	UTSW	1	58350282	missense	probably damaging	0.97
R6766:Aox2	UTSW	1	58349068	missense	possibly damaging	0.95
R6789:Aox2	UTSW	1	58304485	missense	probably benign	0.01
R6804:Aox2	UTSW	1	58304598	missense	probably benign	0.04
R7007:Aox2	UTSW	1	58330892	missense	probably damaging	1.00
R7015:Aox2	UTSW	1	58282758	missense	probably benign	0.00
R7055:Aox2	UTSW	1	58299768	missense	probably benign	0.08
R7089:Aox2	UTSW	1	58336649	missense	probably benign	0.01
R7157:Aox2	UTSW	1	58283492	missense	probably benign	0.00
R7303:Aox2	UTSW	1	58334765	nonsense	probably null
R7426:Aox2	UTSW	1	58289983	nonsense	probably null
R7762:Aox2	UTSW	1	58349104	missense	probably damaging	1.00
R7899:Aox2	UTSW	1	58281237	splice site	probably null
R7942:Aox2	UTSW	1	58337431	missense	probably damaging	1.00
R7975:Aox2	UTSW	1	58309028	missense	probably benign	0.02
R8029:Aox2	UTSW	1	58343668	missense	probably benign	0.32
R8032:Aox2	UTSW	1	58350283	missense	probably benign	0.01
R8147:Aox2	UTSW	1	58300662	missense	probably benign	0.02
R8165:Aox2	UTSW	1	58308929	missense	probably benign	0.08
R8326:Aox2	UTSW	1	58295887	missense	probably benign
R8770:Aox2	UTSW	1	58339604	missense	probably benign	0.10
R8973:Aox2	UTSW	1	58289954	missense	probably benign	0.34
R9015:Aox2	UTSW	1	58343692	missense	probably damaging	1.00
R9097:Aox2	UTSW	1	58287728	missense	possibly damaging	0.82
R9101:Aox2	UTSW	1	58332637	missense	probably benign	0.03
R9108:Aox2	UTSW	1	58282692	missense	probably damaging	1.00
R9180:Aox2	UTSW	1	58339618	nonsense	probably null
R9258:Aox2	UTSW	1	58312356	missense	probably damaging	1.00
R9293:Aox2	UTSW	1	58322794	missense	possibly damaging	0.86
R9519:Aox2	UTSW	1	58334767	missense	probably damaging	0.98
R9581:Aox2	UTSW	1	58330896	critical splice donor site	probably null
Z1177:Aox2	UTSW	1	58354397	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- CCTGCAATCAGGCCACCTTTAACTG -3'
(R):5'- CCAAGCAAGAGCTGAGGTTTACGAC -3'

Sequencing Primer
(F):5'- GGTTCTTCTTGCCTCACACG -3'
(R):5'- tgtgaaggcattagcaggg -3'

Posted On

2015-02-04