Incidental Mutation 'R0131:Tusc1'
ID262205
Institutional Source Beutler Lab
Gene Symbol Tusc1
Ensembl Gene ENSMUSG00000054000
Gene Nametumor suppressor candidate 1
Synonyms2200001D17Rik, TSG-9
MMRRC Submission 038416-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0131 (G1)
Quality Score20
Status Validated
Chromosome4
Chromosomal Location93334138-93335511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93334833 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 196 (H196Q)
Ref Sequence ENSEMBL: ENSMUSP00000069652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066774]
Predicted Effect probably benign
Transcript: ENSMUST00000066774
AA Change: H196Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000069652
Gene: ENSMUSG00000054000
AA Change: H196Q

DomainStartEndE-ValueType
low complexity region 5 52 N/A INTRINSIC
coiled coil region 66 110 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within the region of chromosome 9p that harbors tumor suppressor genes critical in carcinogenesis. It is an intronless gene which is downregulated in non-small-cell lung cancer and small-cell lung cancer cell lines, suggesting that it may play a role in lung tumorigenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,137,615 R320G probably damaging Het
Abcc12 A G 8: 86,531,568 I773T probably benign Het
Adamtsl1 T A 4: 86,342,723 I1057N possibly damaging Het
Anxa5 G A 3: 36,450,672 A247V probably damaging Het
Ascc3 T G 10: 50,735,329 W1589G probably damaging Het
Atp2b2 G A 6: 113,793,782 P389S probably damaging Het
Bpifa6 T A 2: 153,982,931 S9T probably benign Het
Chd8 A G 14: 52,205,326 V589A probably benign Het
Chrnb2 T C 3: 89,764,406 M1V probably null Het
Col16a1 T A 4: 130,067,096 V449E unknown Het
Cttnbp2nl T G 3: 105,005,857 K237T probably damaging Het
Dazap1 T G 10: 80,278,226 probably null Het
Fam187b T A 7: 30,989,120 V22E probably damaging Het
Fat2 A T 11: 55,273,211 S3073T probably benign Het
Gm16069 T C 3: 89,180,925 probably benign Het
Gm4788 T A 1: 139,754,271 T196S probably damaging Het
H2-T24 T A 17: 36,014,986 I238F probably damaging Het
Hectd4 A G 5: 121,333,024 E2658G probably benign Het
Herc1 A C 9: 66,480,910 I3826L probably benign Het
Hinfp A G 9: 44,299,763 C67R probably damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Hspg2 T C 4: 137,551,887 Y3094H probably damaging Het
Htr1f A G 16: 64,926,728 V67A probably damaging Het
Iqcc T G 4: 129,616,599 E374D probably damaging Het
Kcnj9 T C 1: 172,326,198 T120A probably damaging Het
Kif3a A G 11: 53,586,916 K404R possibly damaging Het
Kitl C T 10: 100,087,364 P208S probably benign Het
Lpcat4 A G 2: 112,246,748 Y479C probably damaging Het
Lrrc74b T C 16: 17,553,152 N227S probably damaging Het
Mdc1 T A 17: 35,852,581 V1007D probably damaging Het
Mocos T G 18: 24,679,762 I571S probably benign Het
Myh8 A G 11: 67,292,188 N659D probably damaging Het
Naip2 A G 13: 100,183,788 V240A probably benign Het
Nap1l1 T C 10: 111,485,509 S37P probably benign Het
Nin T G 12: 70,051,141 K515T probably damaging Het
Npl T A 1: 153,509,118 K258* probably null Het
Ntn4 T A 10: 93,644,707 S98T possibly damaging Het
Olfr1037 T C 2: 86,085,500 I92M probably damaging Het
Olfr177 C A 16: 58,872,906 M81I probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr417 T C 1: 174,369,586 V223A probably damaging Het
Pkp2 T C 16: 16,240,713 probably benign Het
Ppox C A 1: 171,279,275 A192S possibly damaging Het
Prkdc T C 16: 15,713,653 L1380S probably benign Het
Psd4 C A 2: 24,405,351 A839E probably damaging Het
Ptprn2 T G 12: 116,722,091 F57V probably damaging Het
Ptprt C T 2: 162,278,110 V146I probably benign Het
R3hdm2 T A 10: 127,498,453 M915K probably damaging Het
Rab26 C T 17: 24,530,785 probably null Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Rprd2 T C 3: 95,774,361 K407E probably damaging Het
Siah3 G A 14: 75,456,134 V27I possibly damaging Het
Slc14a2 T A 18: 78,192,123 N280Y probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc25a35 A G 11: 68,971,960 Y247C probably damaging Het
Slc29a4 A G 5: 142,705,530 D55G probably benign Het
Slc35d1 C T 4: 103,208,181 V189I probably benign Het
Srrm1 G A 4: 135,340,573 R322* probably null Het
Stac3 A T 10: 127,503,650 R138S probably damaging Het
Tbc1d9b T C 11: 50,135,924 I73T probably benign Het
Tgtp1 A G 11: 48,987,332 F182S probably benign Het
Tmcc3 T C 10: 94,545,575 probably benign Het
Tmem116 A G 5: 121,493,782 probably benign Het
Tmem260 T A 14: 48,483,322 C306* probably null Het
Tspyl1 A G 10: 34,283,089 N270S probably damaging Het
Ugt2a1 T A 5: 87,474,861 K293* probably null Het
Vmn2r102 A C 17: 19,678,763 T456P probably benign Het
Vmn2r90 T A 17: 17,712,249 S139R probably benign Het
Zfp879 C A 11: 50,833,599 G210V probably damaging Het
Zmym2 A G 14: 56,943,258 N876D probably benign Het
Other mutations in Tusc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4548:Tusc1 UTSW 4 93335303 small insertion probably benign
FR4589:Tusc1 UTSW 4 93335307 small insertion probably benign
FR4737:Tusc1 UTSW 4 93335313 small insertion probably benign
R2212:Tusc1 UTSW 4 93334936 missense probably damaging 0.99
R3412:Tusc1 UTSW 4 93334936 missense probably damaging 0.99
R3413:Tusc1 UTSW 4 93334936 missense probably damaging 0.99
R3414:Tusc1 UTSW 4 93334936 missense probably damaging 0.99
RF021:Tusc1 UTSW 4 93335316 small insertion probably benign
RF046:Tusc1 UTSW 4 93335302 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTTGTTGGACCCCTCTCAACACAC -3'
(R):5'- AGAACCGCAGCCTCTTCCGC -3'

Sequencing Primer
(F):5'- GAACTGGGAAACTCTTGCTTC -3'
(R):5'- CTTCCGCCAGGCTCTGC -3'
Posted On2015-02-04