Incidental Mutation 'R0131:Zfp879'
ID262207
Institutional Source Beutler Lab
Gene Symbol Zfp879
Ensembl Gene ENSMUSG00000044296
Gene Namezinc finger protein 879
Synonyms
MMRRC Submission 038416-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0131 (G1)
Quality Score32
Status Validated
Chromosome11
Chromosomal Location50832031-50841552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 50833599 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 210 (G210V)
Ref Sequence ENSEMBL: ENSMUSP00000104762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049625] [ENSMUST00000109133] [ENSMUST00000109134]
Predicted Effect probably damaging
Transcript: ENSMUST00000049625
AA Change: G210V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061782
Gene: ENSMUSG00000044296
AA Change: G210V

DomainStartEndE-ValueType
KRAB 14 74 1.54e-33 SMART
ZnF_C2H2 204 226 1.92e-2 SMART
ZnF_C2H2 232 254 1.38e-3 SMART
ZnF_C2H2 260 282 1.16e-1 SMART
ZnF_C2H2 288 310 4.54e-4 SMART
ZnF_C2H2 316 338 8.34e-3 SMART
ZnF_C2H2 344 366 4.87e-4 SMART
ZnF_C2H2 372 394 8.47e-4 SMART
ZnF_C2H2 400 422 1.84e-4 SMART
ZnF_C2H2 428 450 2.57e-3 SMART
ZnF_C2H2 456 478 1.47e-3 SMART
ZnF_C2H2 484 506 3.21e-4 SMART
ZnF_C2H2 512 534 1.5e-4 SMART
ZnF_C2H2 540 562 5.21e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109133
AA Change: G137V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104761
Gene: ENSMUSG00000044296
AA Change: G137V

DomainStartEndE-ValueType
ZnF_C2H2 131 153 1.92e-2 SMART
ZnF_C2H2 159 181 1.38e-3 SMART
ZnF_C2H2 187 209 1.16e-1 SMART
ZnF_C2H2 215 237 4.54e-4 SMART
ZnF_C2H2 243 265 8.34e-3 SMART
ZnF_C2H2 271 293 4.87e-4 SMART
ZnF_C2H2 299 321 8.47e-4 SMART
ZnF_C2H2 327 349 1.84e-4 SMART
ZnF_C2H2 355 377 2.57e-3 SMART
ZnF_C2H2 383 405 1.47e-3 SMART
ZnF_C2H2 411 433 3.21e-4 SMART
ZnF_C2H2 439 461 1.5e-4 SMART
ZnF_C2H2 467 489 5.21e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109134
AA Change: G210V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104762
Gene: ENSMUSG00000044296
AA Change: G210V

DomainStartEndE-ValueType
KRAB 14 74 1.54e-33 SMART
ZnF_C2H2 204 226 1.92e-2 SMART
ZnF_C2H2 232 254 1.38e-3 SMART
ZnF_C2H2 260 282 1.16e-1 SMART
ZnF_C2H2 288 310 4.54e-4 SMART
ZnF_C2H2 316 338 8.34e-3 SMART
ZnF_C2H2 344 366 4.87e-4 SMART
ZnF_C2H2 372 394 8.47e-4 SMART
ZnF_C2H2 400 422 1.84e-4 SMART
ZnF_C2H2 428 450 2.57e-3 SMART
ZnF_C2H2 456 478 1.47e-3 SMART
ZnF_C2H2 484 506 3.21e-4 SMART
ZnF_C2H2 512 534 1.5e-4 SMART
ZnF_C2H2 540 562 5.21e-4 SMART
Meta Mutation Damage Score 0.7853 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,137,615 R320G probably damaging Het
Abcc12 A G 8: 86,531,568 I773T probably benign Het
Adamtsl1 T A 4: 86,342,723 I1057N possibly damaging Het
Anxa5 G A 3: 36,450,672 A247V probably damaging Het
Ascc3 T G 10: 50,735,329 W1589G probably damaging Het
Atp2b2 G A 6: 113,793,782 P389S probably damaging Het
Bpifa6 T A 2: 153,982,931 S9T probably benign Het
Chd8 A G 14: 52,205,326 V589A probably benign Het
Chrnb2 T C 3: 89,764,406 M1V probably null Het
Col16a1 T A 4: 130,067,096 V449E unknown Het
Cttnbp2nl T G 3: 105,005,857 K237T probably damaging Het
Dazap1 T G 10: 80,278,226 probably null Het
Fam187b T A 7: 30,989,120 V22E probably damaging Het
Fat2 A T 11: 55,273,211 S3073T probably benign Het
Gm16069 T C 3: 89,180,925 probably benign Het
Gm4788 T A 1: 139,754,271 T196S probably damaging Het
H2-T24 T A 17: 36,014,986 I238F probably damaging Het
Hectd4 A G 5: 121,333,024 E2658G probably benign Het
Herc1 A C 9: 66,480,910 I3826L probably benign Het
Hinfp A G 9: 44,299,763 C67R probably damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Hspg2 T C 4: 137,551,887 Y3094H probably damaging Het
Htr1f A G 16: 64,926,728 V67A probably damaging Het
Iqcc T G 4: 129,616,599 E374D probably damaging Het
Kcnj9 T C 1: 172,326,198 T120A probably damaging Het
Kif3a A G 11: 53,586,916 K404R possibly damaging Het
Kitl C T 10: 100,087,364 P208S probably benign Het
Lpcat4 A G 2: 112,246,748 Y479C probably damaging Het
Lrrc74b T C 16: 17,553,152 N227S probably damaging Het
Mdc1 T A 17: 35,852,581 V1007D probably damaging Het
Mocos T G 18: 24,679,762 I571S probably benign Het
Myh8 A G 11: 67,292,188 N659D probably damaging Het
Naip2 A G 13: 100,183,788 V240A probably benign Het
Nap1l1 T C 10: 111,485,509 S37P probably benign Het
Nin T G 12: 70,051,141 K515T probably damaging Het
Npl T A 1: 153,509,118 K258* probably null Het
Ntn4 T A 10: 93,644,707 S98T possibly damaging Het
Olfr1037 T C 2: 86,085,500 I92M probably damaging Het
Olfr177 C A 16: 58,872,906 M81I probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr417 T C 1: 174,369,586 V223A probably damaging Het
Pkp2 T C 16: 16,240,713 probably benign Het
Ppox C A 1: 171,279,275 A192S possibly damaging Het
Prkdc T C 16: 15,713,653 L1380S probably benign Het
Psd4 C A 2: 24,405,351 A839E probably damaging Het
Ptprn2 T G 12: 116,722,091 F57V probably damaging Het
Ptprt C T 2: 162,278,110 V146I probably benign Het
R3hdm2 T A 10: 127,498,453 M915K probably damaging Het
Rab26 C T 17: 24,530,785 probably null Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Rprd2 T C 3: 95,774,361 K407E probably damaging Het
Siah3 G A 14: 75,456,134 V27I possibly damaging Het
Slc14a2 T A 18: 78,192,123 N280Y probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc25a35 A G 11: 68,971,960 Y247C probably damaging Het
Slc29a4 A G 5: 142,705,530 D55G probably benign Het
Slc35d1 C T 4: 103,208,181 V189I probably benign Het
Srrm1 G A 4: 135,340,573 R322* probably null Het
Stac3 A T 10: 127,503,650 R138S probably damaging Het
Tbc1d9b T C 11: 50,135,924 I73T probably benign Het
Tgtp1 A G 11: 48,987,332 F182S probably benign Het
Tmcc3 T C 10: 94,545,575 probably benign Het
Tmem116 A G 5: 121,493,782 probably benign Het
Tmem260 T A 14: 48,483,322 C306* probably null Het
Tspyl1 A G 10: 34,283,089 N270S probably damaging Het
Tusc1 A T 4: 93,334,833 H196Q probably benign Het
Ugt2a1 T A 5: 87,474,861 K293* probably null Het
Vmn2r102 A C 17: 19,678,763 T456P probably benign Het
Vmn2r90 T A 17: 17,712,249 S139R probably benign Het
Zmym2 A G 14: 56,943,258 N876D probably benign Het
Other mutations in Zfp879
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01659:Zfp879 APN 11 50838454 missense probably damaging 1.00
IGL02175:Zfp879 APN 11 50837916 missense probably benign 0.13
IGL02259:Zfp879 APN 11 50838428 missense probably benign 0.00
R1430:Zfp879 UTSW 11 50833957 missense probably benign 0.00
R1576:Zfp879 UTSW 11 50833549 missense probably benign 0.41
R1616:Zfp879 UTSW 11 50832646 missense probably benign 0.06
R1701:Zfp879 UTSW 11 50833233 missense possibly damaging 0.77
R1965:Zfp879 UTSW 11 50833528 missense probably damaging 1.00
R2057:Zfp879 UTSW 11 50832601 missense probably benign
R2058:Zfp879 UTSW 11 50832601 missense probably benign
R2219:Zfp879 UTSW 11 50833267 missense probably damaging 1.00
R3110:Zfp879 UTSW 11 50833162 missense possibly damaging 0.87
R3112:Zfp879 UTSW 11 50833162 missense possibly damaging 0.87
R4658:Zfp879 UTSW 11 50833197 missense probably damaging 1.00
R4845:Zfp879 UTSW 11 50833845 missense probably damaging 1.00
R4998:Zfp879 UTSW 11 50837969 missense probably damaging 1.00
R6362:Zfp879 UTSW 11 50838475 missense probably damaging 0.98
R6930:Zfp879 UTSW 11 50833012 missense probably damaging 1.00
R7091:Zfp879 UTSW 11 50833395 missense probably damaging 0.99
R7186:Zfp879 UTSW 11 50833794 missense probably benign 0.06
R7218:Zfp879 UTSW 11 50832681 missense possibly damaging 0.61
R8138:Zfp879 UTSW 11 50833448 nonsense probably null
X0066:Zfp879 UTSW 11 50833087 missense possibly damaging 0.89
Z1177:Zfp879 UTSW 11 50833431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGTCTGCTCAGCCGTGATA -3'
(R):5'- TGAGAAATCCCGGCATAAAGCTCC -3'

Sequencing Primer
(F):5'- gtcttgccacattccttacattc -3'
(R):5'- GGCATAAAGCTCCCATTTCGTAG -3'
Posted On2015-02-04