Incidental Mutation 'R0812:Fat4'
ID 262294
Institutional Source Beutler Lab
Gene Symbol Fat4
Ensembl Gene ENSMUSG00000046743
Gene Name FAT atypical cadherin 4
Synonyms 6030410K14Rik
MMRRC Submission 038992-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0812 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 38941089-39066134 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 39011623 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 2241 (D2241V)
Ref Sequence ENSEMBL: ENSMUSP00000061836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061260]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000061260
AA Change: D2241V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061836
Gene: ENSMUSG00000046743
AA Change: D2241V

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
CA 60 133 4.09e-7 SMART
CA 157 248 4.51e-18 SMART
CA 272 351 7.66e-30 SMART
CA 380 473 2.55e-17 SMART
CA 497 580 8.27e-26 SMART
CA 605 687 6.46e-28 SMART
CA 711 791 1e-24 SMART
CA 815 891 3.78e-20 SMART
CA 915 994 8.6e-24 SMART
CA 1018 1098 7.09e-25 SMART
CA 1122 1208 6.78e-22 SMART
CA 1232 1313 2.63e-28 SMART
CA 1337 1418 7.25e-31 SMART
CA 1442 1527 4.58e-19 SMART
CA 1550 1629 4.52e-9 SMART
CA 1651 1738 1.3e-9 SMART
CA 1762 1839 2.01e-24 SMART
CA 1863 1942 3.11e-21 SMART
CA 1966 2049 5.85e-26 SMART
CA 2072 2152 1.88e-29 SMART
CA 2176 2257 3.06e-29 SMART
CA 2282 2362 2.61e-23 SMART
CA 2386 2466 2.99e-32 SMART
CA 2490 2568 9.92e-6 SMART
CA 2588 2669 6.58e-20 SMART
CA 2692 2773 7.25e-31 SMART
CA 2796 2872 1.69e-22 SMART
CA 2896 2983 3.16e-22 SMART
CA 3007 3089 1.01e-15 SMART
CA 3113 3194 1.25e-25 SMART
CA 3218 3298 7e-15 SMART
CA 3322 3405 3.96e-14 SMART
CA 3428 3510 3.41e-27 SMART
CA 3532 3614 5.64e-19 SMART
EGF 3807 3862 1.78e-2 SMART
EGF_CA 3864 3900 2.36e-16 SMART
EGF_CA 3902 3938 7.99e-14 SMART
EGF 3943 3976 1.24e-1 SMART
LamG 3996 4144 4.08e-19 SMART
EGF 4167 4200 5.88e-3 SMART
LamG 4244 4375 1.76e-23 SMART
EGF 4430 4464 1.41e-5 SMART
low complexity region 4514 4526 N/A INTRINSIC
low complexity region 4533 4550 N/A INTRINSIC
low complexity region 4840 4849 N/A INTRINSIC
Meta Mutation Damage Score 0.1949 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.8%
  • 20x: 91.7%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protocadherin family. This gene may play a role in regulating planar cell polarity (PCP). Studies in mice suggest that loss of PCP signaling may cause cystic kidney disease, and mutations in this gene have been associated with Van Maldergem Syndrome 2. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, reduced birth body size, curly tails, kyphosis, small lungs, renal cysts, and defects in sternum and vertebrae morphology, neural tube width, cochlear elongation, stereocilia orientation, kidney development, and intestinal elongation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,763,229 (GRCm39) S586P probably damaging Het
Abcc3 G A 11: 94,266,028 (GRCm39) probably benign Het
Ap5z1 G A 5: 142,461,546 (GRCm39) R583H probably benign Het
Arrb1 G T 7: 99,247,708 (GRCm39) V346L probably benign Het
Atrnl1 T A 19: 57,661,573 (GRCm39) F518I probably benign Het
Bank1 T A 3: 135,799,127 (GRCm39) I405F probably damaging Het
Cacna1c A G 6: 118,607,224 (GRCm39) C1227R probably benign Het
Cacna1h A G 17: 25,607,602 (GRCm39) L905P probably damaging Het
Cc2d1a A G 8: 84,860,465 (GRCm39) Y826H probably benign Het
Cenpo A G 12: 4,266,643 (GRCm39) V155A probably benign Het
Cnmd A G 14: 79,898,863 (GRCm39) F63S probably damaging Het
Cnn3 G A 3: 121,248,600 (GRCm39) G72D probably damaging Het
Cox10 A G 11: 63,962,539 (GRCm39) S101P probably benign Het
Ctdsp1 T C 1: 74,433,806 (GRCm39) V129A probably damaging Het
Cyp2d34 A T 15: 82,502,807 (GRCm39) S140T probably benign Het
Dennd5a G A 7: 109,532,820 (GRCm39) H317Y possibly damaging Het
Dnaaf9 A G 2: 130,555,334 (GRCm39) F858S probably damaging Het
Eef2 C CN 10: 81,014,603 (GRCm39) probably null Het
Enox1 T A 14: 77,819,876 (GRCm39) D210E probably damaging Het
Fam171a1 A G 2: 3,198,464 (GRCm39) N190S probably damaging Het
Fat2 T A 11: 55,144,459 (GRCm39) K4138N possibly damaging Het
Fbn1 C T 2: 125,245,090 (GRCm39) V266I possibly damaging Het
Foxf2 T A 13: 31,811,188 (GRCm39) Y376N probably damaging Het
Fras1 T A 5: 96,900,857 (GRCm39) S3025R probably benign Het
Gba1 T C 3: 89,111,307 (GRCm39) I24T probably benign Het
Gdpd5 A G 7: 99,087,540 (GRCm39) D68G probably damaging Het
Grid1 G A 14: 34,544,576 (GRCm39) S49N probably benign Het
Grtp1 T C 8: 13,229,639 (GRCm39) T250A possibly damaging Het
Gucy1b1 T C 3: 81,945,295 (GRCm39) N448D probably benign Het
H2-Ob A G 17: 34,463,100 (GRCm39) probably benign Het
Hcn4 A G 9: 58,730,795 (GRCm39) M1V probably null Het
Hmcn2 G A 2: 31,310,383 (GRCm39) A3326T probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,078,302 (GRCm39) probably benign Het
Ippk C A 13: 49,596,947 (GRCm39) Q254K probably damaging Het
Itga2 A T 13: 115,007,150 (GRCm39) L393I possibly damaging Het
Kcna10 A T 3: 107,102,575 (GRCm39) E402V possibly damaging Het
Kcnab1 G A 3: 65,205,141 (GRCm39) D119N probably damaging Het
Kcnip4 T A 5: 48,567,202 (GRCm39) T122S probably benign Het
Kcnma1 G A 14: 23,350,086 (GRCm39) P1151L probably damaging Het
Klhl22 T A 16: 17,610,453 (GRCm39) M568K probably benign Het
Krt6a C T 15: 101,601,183 (GRCm39) V257M probably damaging Het
Ksr2 A C 5: 117,693,290 (GRCm39) H246P probably damaging Het
Lca5 T C 9: 83,281,806 (GRCm39) D326G possibly damaging Het
Lcp1 A G 14: 75,451,928 (GRCm39) E393G probably benign Het
Leo1 G A 9: 75,352,831 (GRCm39) E125K probably benign Het
Lipt1 T A 1: 37,914,382 (GRCm39) V146E probably damaging Het
Mael A T 1: 166,062,968 (GRCm39) probably null Het
Mga C T 2: 119,778,442 (GRCm39) L1996F probably damaging Het
Mllt6 A G 11: 97,569,387 (GRCm39) N913S probably damaging Het
Mphosph9 A C 5: 124,436,822 (GRCm39) D507E probably damaging Het
Mvp G A 7: 126,586,728 (GRCm39) A801V probably benign Het
Ndrg2 A G 14: 52,146,119 (GRCm39) probably benign Het
Neb T C 2: 52,182,707 (GRCm39) D1053G possibly damaging Het
Nubp1 C A 16: 10,231,585 (GRCm39) L79I probably benign Het
Or1e1f G A 11: 73,856,246 (GRCm39) E271K probably benign Het
Or1o2 A C 17: 37,543,223 (GRCm39) L13V probably benign Het
Or8d2 G A 9: 38,759,805 (GRCm39) V132I probably benign Het
Pnpla8 G A 12: 44,330,188 (GRCm39) V29M probably benign Het
Psmb2 T A 4: 126,601,350 (GRCm39) I151N possibly damaging Het
Ptgs2 C T 1: 149,977,105 (GRCm39) T104I probably benign Het
Ptpro A G 6: 137,345,077 (GRCm39) T28A probably benign Het
Raf1 A G 6: 115,603,671 (GRCm39) probably null Het
Ranbp2 T C 10: 58,301,351 (GRCm39) M668T probably benign Het
Rbm48 A T 5: 3,641,760 (GRCm39) probably null Het
Rhag A T 17: 41,142,469 (GRCm39) T225S possibly damaging Het
Rhof A C 5: 123,269,950 (GRCm39) L69R probably damaging Het
Slc24a5 T C 2: 124,910,724 (GRCm39) S52P probably damaging Het
Slc8a2 T C 7: 15,875,039 (GRCm39) V429A probably damaging Het
Slfn10-ps G A 11: 82,926,388 (GRCm39) noncoding transcript Het
Spam1 G A 6: 24,796,886 (GRCm39) R279H probably damaging Het
Srfbp1 A G 18: 52,620,588 (GRCm39) D102G probably damaging Het
Srrm3 A C 5: 135,902,136 (GRCm39) probably benign Het
Tk1 T C 11: 117,712,933 (GRCm39) E98G probably damaging Het
Trim13 G A 14: 61,843,149 (GRCm39) V389I probably benign Het
Ttc28 A T 5: 111,383,366 (GRCm39) Y1289F probably benign Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Ugt1a10 T A 1: 87,983,904 (GRCm39) V234D probably benign Het
Vmn2r18 C A 5: 151,496,395 (GRCm39) probably benign Het
Vmn2r75 C T 7: 85,814,575 (GRCm39) G306E probably benign Het
Vmn2r86 C T 10: 130,289,497 (GRCm39) V133I probably benign Het
Vps13c C A 9: 67,841,758 (GRCm39) Q1927K probably benign Het
Zbtb14 C A 17: 69,695,497 (GRCm39) F398L probably damaging Het
Zfp219 T A 14: 52,244,395 (GRCm39) T550S probably benign Het
Zfp329 T A 7: 12,545,395 (GRCm39) N43I probably benign Het
Zfp507 G A 7: 35,502,048 (GRCm39) probably benign Het
Zfp97 T A 17: 17,365,552 (GRCm39) F350L possibly damaging Het
Other mutations in Fat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Fat4 APN 3 39,036,398 (GRCm39) missense probably damaging 1.00
IGL00509:Fat4 APN 3 38,943,188 (GRCm39) missense probably damaging 1.00
IGL00698:Fat4 APN 3 39,035,294 (GRCm39) missense probably benign 0.17
IGL00934:Fat4 APN 3 38,944,822 (GRCm39) missense probably damaging 1.00
IGL01063:Fat4 APN 3 38,944,728 (GRCm39) missense possibly damaging 0.80
IGL01123:Fat4 APN 3 39,011,418 (GRCm39) missense probably benign 0.00
IGL01313:Fat4 APN 3 39,061,350 (GRCm39) missense possibly damaging 0.53
IGL01328:Fat4 APN 3 39,034,807 (GRCm39) missense probably damaging 1.00
IGL01328:Fat4 APN 3 38,944,140 (GRCm39) missense probably damaging 1.00
IGL01374:Fat4 APN 3 38,941,647 (GRCm39) missense probably damaging 1.00
IGL01412:Fat4 APN 3 38,945,330 (GRCm39) missense probably benign 0.09
IGL01472:Fat4 APN 3 38,942,219 (GRCm39) missense probably damaging 1.00
IGL01514:Fat4 APN 3 39,003,683 (GRCm39) missense possibly damaging 0.89
IGL01548:Fat4 APN 3 39,063,406 (GRCm39) missense probably damaging 1.00
IGL01548:Fat4 APN 3 38,941,907 (GRCm39) missense probably damaging 0.99
IGL01576:Fat4 APN 3 38,943,096 (GRCm39) missense probably damaging 1.00
IGL01591:Fat4 APN 3 39,064,524 (GRCm39) nonsense probably null
IGL01626:Fat4 APN 3 39,005,181 (GRCm39) missense probably damaging 1.00
IGL01746:Fat4 APN 3 39,045,880 (GRCm39) nonsense probably null
IGL01800:Fat4 APN 3 39,035,878 (GRCm39) missense probably damaging 0.99
IGL01815:Fat4 APN 3 38,942,922 (GRCm39) missense probably damaging 1.00
IGL01863:Fat4 APN 3 39,024,768 (GRCm39) splice site probably benign
IGL01917:Fat4 APN 3 38,943,879 (GRCm39) missense possibly damaging 0.89
IGL01936:Fat4 APN 3 39,033,923 (GRCm39) missense probably benign 0.10
IGL02060:Fat4 APN 3 39,064,420 (GRCm39) missense probably damaging 1.00
IGL02103:Fat4 APN 3 38,943,348 (GRCm39) missense probably damaging 0.97
IGL02119:Fat4 APN 3 39,037,088 (GRCm39) missense probably benign 0.10
IGL02124:Fat4 APN 3 38,942,553 (GRCm39) missense probably damaging 1.00
IGL02164:Fat4 APN 3 39,050,354 (GRCm39) critical splice donor site probably null
IGL02182:Fat4 APN 3 38,944,695 (GRCm39) missense probably damaging 1.00
IGL02207:Fat4 APN 3 39,005,412 (GRCm39) missense probably benign 0.16
IGL02210:Fat4 APN 3 38,946,002 (GRCm39) missense probably benign 0.01
IGL02257:Fat4 APN 3 39,055,288 (GRCm39) missense probably benign 0.09
IGL02271:Fat4 APN 3 39,034,068 (GRCm39) missense probably benign 0.18
IGL02305:Fat4 APN 3 39,064,137 (GRCm39) missense probably damaging 1.00
IGL02314:Fat4 APN 3 38,941,779 (GRCm39) missense probably damaging 1.00
IGL02455:Fat4 APN 3 39,005,280 (GRCm39) missense possibly damaging 0.48
IGL02468:Fat4 APN 3 39,037,195 (GRCm39) missense probably benign
IGL02478:Fat4 APN 3 38,942,364 (GRCm39) missense probably damaging 1.00
IGL02480:Fat4 APN 3 39,064,579 (GRCm39) missense probably damaging 1.00
IGL02487:Fat4 APN 3 38,941,394 (GRCm39) missense probably damaging 1.00
IGL02632:Fat4 APN 3 39,056,913 (GRCm39) missense probably benign 0.04
IGL02665:Fat4 APN 3 39,056,985 (GRCm39) missense probably benign 0.08
IGL02674:Fat4 APN 3 39,037,486 (GRCm39) missense probably benign 0.35
IGL02692:Fat4 APN 3 39,005,235 (GRCm39) missense probably damaging 1.00
IGL02710:Fat4 APN 3 38,944,744 (GRCm39) missense probably damaging 1.00
IGL02803:Fat4 APN 3 38,943,444 (GRCm39) missense probably damaging 1.00
IGL02834:Fat4 APN 3 39,010,893 (GRCm39) missense probably damaging 1.00
IGL02891:Fat4 APN 3 39,005,422 (GRCm39) missense probably damaging 1.00
IGL02982:Fat4 APN 3 38,944,992 (GRCm39) missense probably damaging 1.00
IGL02993:Fat4 APN 3 39,011,304 (GRCm39) missense probably damaging 1.00
IGL02996:Fat4 APN 3 39,012,674 (GRCm39) missense probably damaging 1.00
IGL03029:Fat4 APN 3 39,036,740 (GRCm39) missense possibly damaging 0.46
IGL03124:Fat4 APN 3 39,035,701 (GRCm39) missense possibly damaging 0.61
IGL03144:Fat4 APN 3 39,011,008 (GRCm39) missense possibly damaging 0.68
IGL03149:Fat4 APN 3 39,045,834 (GRCm39) missense probably damaging 1.00
IGL03169:Fat4 APN 3 39,011,547 (GRCm39) missense probably benign 0.02
IGL03190:Fat4 APN 3 39,035,390 (GRCm39) missense probably damaging 1.00
IGL03272:Fat4 APN 3 39,063,852 (GRCm39) missense probably benign
IGL03371:Fat4 APN 3 39,037,336 (GRCm39) missense possibly damaging 0.65
IGL03372:Fat4 APN 3 38,943,283 (GRCm39) missense possibly damaging 0.88
IGL03388:Fat4 APN 3 39,011,376 (GRCm39) missense probably damaging 1.00
IGL03394:Fat4 APN 3 38,946,168 (GRCm39) missense probably damaging 0.99
IGL03394:Fat4 APN 3 39,063,513 (GRCm39) missense probably damaging 1.00
IGL03405:Fat4 APN 3 39,012,599 (GRCm39) missense probably benign 0.02
IGL03410:Fat4 APN 3 38,945,325 (GRCm39) missense probably damaging 1.00
Asahi UTSW 3 39,035,968 (GRCm39) missense probably damaging 1.00
Expulsion UTSW 3 38,943,798 (GRCm39) missense probably benign 0.00
heineken UTSW 3 39,034,529 (GRCm39) missense probably damaging 1.00
schlitz UTSW 3 39,034,808 (GRCm39) missense probably damaging 1.00
PIT4696001:Fat4 UTSW 3 39,036,506 (GRCm39) missense probably damaging 0.98
PIT4696001:Fat4 UTSW 3 38,943,153 (GRCm39) missense probably benign 0.04
R0015:Fat4 UTSW 3 39,036,652 (GRCm39) missense probably damaging 1.00
R0015:Fat4 UTSW 3 39,036,652 (GRCm39) missense probably damaging 1.00
R0078:Fat4 UTSW 3 38,943,080 (GRCm39) missense probably benign 0.35
R0100:Fat4 UTSW 3 39,034,397 (GRCm39) missense probably damaging 1.00
R0100:Fat4 UTSW 3 39,034,397 (GRCm39) missense probably damaging 1.00
R0201:Fat4 UTSW 3 38,945,745 (GRCm39) missense probably damaging 0.99
R0280:Fat4 UTSW 3 38,944,965 (GRCm39) missense probably benign
R0357:Fat4 UTSW 3 38,945,376 (GRCm39) missense probably damaging 1.00
R0409:Fat4 UTSW 3 39,031,562 (GRCm39) missense probably damaging 1.00
R0498:Fat4 UTSW 3 39,034,786 (GRCm39) missense probably benign 0.00
R0502:Fat4 UTSW 3 39,057,073 (GRCm39) missense probably damaging 0.98
R0506:Fat4 UTSW 3 38,942,463 (GRCm39) missense probably benign 0.00
R0532:Fat4 UTSW 3 39,035,870 (GRCm39) missense probably benign 0.02
R0616:Fat4 UTSW 3 38,997,019 (GRCm39) missense probably damaging 1.00
R0630:Fat4 UTSW 3 39,054,321 (GRCm39) missense probably damaging 1.00
R0678:Fat4 UTSW 3 38,943,843 (GRCm39) missense probably damaging 1.00
R0685:Fat4 UTSW 3 39,055,327 (GRCm39) missense probably benign
R0729:Fat4 UTSW 3 39,054,444 (GRCm39) splice site probably benign
R0748:Fat4 UTSW 3 38,941,977 (GRCm39) missense possibly damaging 0.67
R0811:Fat4 UTSW 3 39,011,623 (GRCm39) missense probably damaging 1.00
R0830:Fat4 UTSW 3 39,053,258 (GRCm39) missense probably benign 0.26
R0841:Fat4 UTSW 3 39,050,147 (GRCm39) missense probably damaging 0.99
R0884:Fat4 UTSW 3 39,037,007 (GRCm39) missense possibly damaging 0.89
R1056:Fat4 UTSW 3 38,945,541 (GRCm39) missense probably damaging 1.00
R1066:Fat4 UTSW 3 39,011,376 (GRCm39) missense probably damaging 1.00
R1078:Fat4 UTSW 3 39,037,235 (GRCm39) missense probably benign 0.10
R1084:Fat4 UTSW 3 39,033,974 (GRCm39) missense possibly damaging 0.88
R1118:Fat4 UTSW 3 39,037,091 (GRCm39) missense possibly damaging 0.88
R1213:Fat4 UTSW 3 38,944,520 (GRCm39) missense probably benign 0.01
R1418:Fat4 UTSW 3 38,944,962 (GRCm39) missense probably damaging 1.00
R1475:Fat4 UTSW 3 38,942,472 (GRCm39) missense probably damaging 1.00
R1487:Fat4 UTSW 3 39,050,066 (GRCm39) missense possibly damaging 0.77
R1511:Fat4 UTSW 3 39,037,225 (GRCm39) missense probably damaging 0.97
R1534:Fat4 UTSW 3 38,944,238 (GRCm39) missense probably damaging 1.00
R1558:Fat4 UTSW 3 38,943,135 (GRCm39) missense probably damaging 1.00
R1586:Fat4 UTSW 3 38,943,009 (GRCm39) missense probably damaging 1.00
R1592:Fat4 UTSW 3 39,061,326 (GRCm39) missense probably damaging 0.99
R1655:Fat4 UTSW 3 39,011,467 (GRCm39) missense probably damaging 0.97
R1662:Fat4 UTSW 3 39,034,928 (GRCm39) missense probably damaging 1.00
R1710:Fat4 UTSW 3 39,005,304 (GRCm39) missense probably damaging 1.00
R1731:Fat4 UTSW 3 38,945,459 (GRCm39) missense probably damaging 1.00
R1761:Fat4 UTSW 3 38,941,638 (GRCm39) missense possibly damaging 0.61
R1770:Fat4 UTSW 3 39,064,417 (GRCm39) missense probably damaging 1.00
R1828:Fat4 UTSW 3 39,037,607 (GRCm39) missense probably damaging 1.00
R1835:Fat4 UTSW 3 39,037,720 (GRCm39) missense probably benign 0.00
R1846:Fat4 UTSW 3 39,036,532 (GRCm39) missense probably benign 0.00
R1861:Fat4 UTSW 3 39,064,633 (GRCm39) missense probably benign 0.09
R1871:Fat4 UTSW 3 39,035,221 (GRCm39) missense possibly damaging 0.63
R1981:Fat4 UTSW 3 39,045,813 (GRCm39) missense probably damaging 1.00
R1988:Fat4 UTSW 3 39,050,239 (GRCm39) missense probably damaging 1.00
R1988:Fat4 UTSW 3 38,941,264 (GRCm39) missense probably benign
R2056:Fat4 UTSW 3 38,945,319 (GRCm39) missense possibly damaging 0.88
R2058:Fat4 UTSW 3 38,945,319 (GRCm39) missense possibly damaging 0.88
R2059:Fat4 UTSW 3 38,945,319 (GRCm39) missense possibly damaging 0.88
R2070:Fat4 UTSW 3 39,064,804 (GRCm39) missense probably benign 0.00
R2078:Fat4 UTSW 3 38,943,822 (GRCm39) missense probably damaging 1.00
R2114:Fat4 UTSW 3 39,035,633 (GRCm39) missense probably benign 0.01
R2135:Fat4 UTSW 3 39,034,882 (GRCm39) missense probably damaging 0.98
R2152:Fat4 UTSW 3 39,037,544 (GRCm39) missense probably damaging 1.00
R2153:Fat4 UTSW 3 39,037,544 (GRCm39) missense probably damaging 1.00
R2154:Fat4 UTSW 3 38,941,688 (GRCm39) missense probably damaging 1.00
R2196:Fat4 UTSW 3 39,035,566 (GRCm39) missense probably benign 0.23
R2211:Fat4 UTSW 3 38,945,676 (GRCm39) missense possibly damaging 0.77
R2219:Fat4 UTSW 3 39,064,364 (GRCm39) missense probably damaging 1.00
R2247:Fat4 UTSW 3 38,946,198 (GRCm39) missense probably damaging 1.00
R2263:Fat4 UTSW 3 38,943,138 (GRCm39) missense possibly damaging 0.93
R2264:Fat4 UTSW 3 38,944,571 (GRCm39) missense probably benign 0.25
R2274:Fat4 UTSW 3 39,050,048 (GRCm39) missense possibly damaging 0.47
R2337:Fat4 UTSW 3 39,034,160 (GRCm39) missense probably damaging 1.00
R2343:Fat4 UTSW 3 39,011,254 (GRCm39) missense probably damaging 0.97
R2365:Fat4 UTSW 3 39,034,568 (GRCm39) missense probably benign
R2412:Fat4 UTSW 3 39,011,221 (GRCm39) missense probably benign 0.05
R2883:Fat4 UTSW 3 39,034,953 (GRCm39) missense probably damaging 1.00
R2942:Fat4 UTSW 3 39,036,485 (GRCm39) missense probably damaging 1.00
R2989:Fat4 UTSW 3 39,061,302 (GRCm39) missense probably benign
R3103:Fat4 UTSW 3 38,946,089 (GRCm39) missense probably benign 0.03
R3158:Fat4 UTSW 3 38,944,940 (GRCm39) missense possibly damaging 0.87
R3800:Fat4 UTSW 3 39,035,423 (GRCm39) missense possibly damaging 0.48
R3808:Fat4 UTSW 3 39,036,587 (GRCm39) missense possibly damaging 0.52
R3848:Fat4 UTSW 3 39,061,410 (GRCm39) missense probably benign 0.10
R3850:Fat4 UTSW 3 39,061,410 (GRCm39) missense probably benign 0.10
R3957:Fat4 UTSW 3 39,036,495 (GRCm39) missense probably benign
R4065:Fat4 UTSW 3 39,063,346 (GRCm39) missense probably benign 0.13
R4078:Fat4 UTSW 3 39,034,169 (GRCm39) missense probably damaging 1.00
R4096:Fat4 UTSW 3 38,942,024 (GRCm39) missense possibly damaging 0.46
R4161:Fat4 UTSW 3 38,996,958 (GRCm39) missense possibly damaging 0.95
R4273:Fat4 UTSW 3 38,945,776 (GRCm39) missense probably damaging 1.00
R4285:Fat4 UTSW 3 38,943,320 (GRCm39) missense probably benign 0.00
R4288:Fat4 UTSW 3 38,945,912 (GRCm39) missense probably damaging 1.00
R4407:Fat4 UTSW 3 39,012,689 (GRCm39) missense probably benign 0.05
R4528:Fat4 UTSW 3 38,945,443 (GRCm39) missense probably benign 0.01
R4547:Fat4 UTSW 3 39,005,432 (GRCm39) missense probably damaging 1.00
R4681:Fat4 UTSW 3 38,941,491 (GRCm39) missense probably damaging 1.00
R4826:Fat4 UTSW 3 39,037,106 (GRCm39) missense probably damaging 1.00
R4855:Fat4 UTSW 3 38,942,466 (GRCm39) missense probably benign
R4871:Fat4 UTSW 3 38,945,754 (GRCm39) missense probably damaging 1.00
R4897:Fat4 UTSW 3 39,034,781 (GRCm39) missense probably damaging 1.00
R4928:Fat4 UTSW 3 39,064,614 (GRCm39) missense probably damaging 1.00
R4932:Fat4 UTSW 3 39,061,352 (GRCm39) missense probably benign 0.00
R4941:Fat4 UTSW 3 39,011,601 (GRCm39) missense probably damaging 1.00
R4943:Fat4 UTSW 3 39,034,322 (GRCm39) missense probably benign 0.19
R4959:Fat4 UTSW 3 39,037,195 (GRCm39) missense probably benign 0.00
R4973:Fat4 UTSW 3 39,037,195 (GRCm39) missense probably benign 0.00
R5098:Fat4 UTSW 3 38,942,438 (GRCm39) missense probably benign 0.34
R5163:Fat4 UTSW 3 39,034,946 (GRCm39) missense probably damaging 1.00
R5213:Fat4 UTSW 3 39,034,340 (GRCm39) missense possibly damaging 0.56
R5328:Fat4 UTSW 3 39,011,017 (GRCm39) missense probably damaging 1.00
R5337:Fat4 UTSW 3 39,064,527 (GRCm39) missense probably benign 0.44
R5337:Fat4 UTSW 3 38,945,776 (GRCm39) missense probably damaging 1.00
R5363:Fat4 UTSW 3 38,942,154 (GRCm39) missense probably damaging 1.00
R5380:Fat4 UTSW 3 38,943,013 (GRCm39) missense probably damaging 1.00
R5384:Fat4 UTSW 3 39,050,095 (GRCm39) missense possibly damaging 0.87
R5422:Fat4 UTSW 3 38,941,394 (GRCm39) missense possibly damaging 0.92
R5436:Fat4 UTSW 3 38,945,495 (GRCm39) missense probably benign 0.00
R5443:Fat4 UTSW 3 39,064,519 (GRCm39) missense probably damaging 1.00
R5501:Fat4 UTSW 3 38,941,364 (GRCm39) missense probably benign 0.09
R5571:Fat4 UTSW 3 39,064,423 (GRCm39) missense probably damaging 1.00
R5625:Fat4 UTSW 3 38,943,083 (GRCm39) missense possibly damaging 0.78
R5652:Fat4 UTSW 3 39,057,117 (GRCm39) missense probably damaging 0.99
R5725:Fat4 UTSW 3 38,943,774 (GRCm39) missense probably damaging 1.00
R5735:Fat4 UTSW 3 39,003,725 (GRCm39) missense probably damaging 1.00
R5739:Fat4 UTSW 3 39,037,283 (GRCm39) missense probably benign 0.01
R5766:Fat4 UTSW 3 38,943,617 (GRCm39) missense probably damaging 1.00
R5780:Fat4 UTSW 3 39,035,104 (GRCm39) missense probably damaging 0.96
R5811:Fat4 UTSW 3 38,945,936 (GRCm39) missense probably damaging 1.00
R5829:Fat4 UTSW 3 39,061,454 (GRCm39) missense probably damaging 1.00
R5879:Fat4 UTSW 3 38,941,485 (GRCm39) missense probably benign
R5933:Fat4 UTSW 3 39,005,524 (GRCm39) critical splice donor site probably null
R5938:Fat4 UTSW 3 39,005,388 (GRCm39) missense probably damaging 1.00
R5940:Fat4 UTSW 3 38,943,798 (GRCm39) missense probably benign 0.00
R5945:Fat4 UTSW 3 39,037,355 (GRCm39) missense probably benign 0.19
R5963:Fat4 UTSW 3 39,064,696 (GRCm39) missense probably damaging 1.00
R6077:Fat4 UTSW 3 39,056,951 (GRCm39) missense probably damaging 1.00
R6158:Fat4 UTSW 3 39,037,411 (GRCm39) missense possibly damaging 0.95
R6246:Fat4 UTSW 3 38,945,870 (GRCm39) missense probably damaging 1.00
R6253:Fat4 UTSW 3 39,005,505 (GRCm39) missense probably damaging 0.99
R6259:Fat4 UTSW 3 39,061,395 (GRCm39) missense probably benign 0.18
R6295:Fat4 UTSW 3 39,061,229 (GRCm39) splice site probably null
R6387:Fat4 UTSW 3 39,037,934 (GRCm39) missense probably damaging 1.00
R6390:Fat4 UTSW 3 39,034,529 (GRCm39) missense probably damaging 1.00
R6456:Fat4 UTSW 3 39,038,128 (GRCm39) missense possibly damaging 0.90
R6493:Fat4 UTSW 3 38,945,036 (GRCm39) missense probably damaging 1.00
R6500:Fat4 UTSW 3 39,035,418 (GRCm39) nonsense probably null
R6503:Fat4 UTSW 3 39,036,406 (GRCm39) missense probably benign 0.00
R6519:Fat4 UTSW 3 39,057,020 (GRCm39) missense probably benign
R6566:Fat4 UTSW 3 39,011,275 (GRCm39) missense possibly damaging 0.78
R6576:Fat4 UTSW 3 39,033,839 (GRCm39) missense probably benign
R6590:Fat4 UTSW 3 39,037,688 (GRCm39) missense probably damaging 1.00
R6658:Fat4 UTSW 3 38,997,077 (GRCm39) missense probably benign 0.01
R6662:Fat4 UTSW 3 39,010,970 (GRCm39) missense possibly damaging 0.95
R6690:Fat4 UTSW 3 39,037,688 (GRCm39) missense probably damaging 1.00
R6807:Fat4 UTSW 3 39,036,589 (GRCm39) missense probably benign 0.18
R6823:Fat4 UTSW 3 39,038,088 (GRCm39) missense probably benign 0.05
R6824:Fat4 UTSW 3 39,011,674 (GRCm39) missense probably benign 0.00
R6830:Fat4 UTSW 3 39,035,966 (GRCm39) missense probably benign 0.00
R6925:Fat4 UTSW 3 39,050,353 (GRCm39) critical splice donor site probably null
R6948:Fat4 UTSW 3 39,063,595 (GRCm39) missense probably damaging 1.00
R6970:Fat4 UTSW 3 39,050,120 (GRCm39) missense probably damaging 1.00
R6970:Fat4 UTSW 3 39,035,924 (GRCm39) missense probably damaging 1.00
R7017:Fat4 UTSW 3 38,945,692 (GRCm39) missense probably benign
R7030:Fat4 UTSW 3 39,036,107 (GRCm39) missense probably damaging 1.00
R7044:Fat4 UTSW 3 39,064,960 (GRCm39) missense probably benign 0.02
R7044:Fat4 UTSW 3 39,064,959 (GRCm39) missense probably benign
R7045:Fat4 UTSW 3 38,942,750 (GRCm39) missense probably benign 0.01
R7094:Fat4 UTSW 3 38,944,023 (GRCm39) missense probably damaging 1.00
R7111:Fat4 UTSW 3 39,064,682 (GRCm39) missense probably damaging 1.00
R7130:Fat4 UTSW 3 39,034,936 (GRCm39) missense probably damaging 0.99
R7168:Fat4 UTSW 3 39,034,808 (GRCm39) missense probably damaging 1.00
R7192:Fat4 UTSW 3 39,034,613 (GRCm39) missense probably benign 0.04
R7194:Fat4 UTSW 3 39,038,044 (GRCm39) missense probably damaging 1.00
R7194:Fat4 UTSW 3 38,943,033 (GRCm39) missense probably damaging 1.00
R7199:Fat4 UTSW 3 39,031,511 (GRCm39) missense probably damaging 0.98
R7213:Fat4 UTSW 3 39,053,236 (GRCm39) missense possibly damaging 0.63
R7216:Fat4 UTSW 3 38,945,192 (GRCm39) missense probably damaging 1.00
R7225:Fat4 UTSW 3 39,034,325 (GRCm39) missense possibly damaging 0.50
R7238:Fat4 UTSW 3 38,944,562 (GRCm39) missense probably benign 0.31
R7239:Fat4 UTSW 3 39,037,989 (GRCm39) missense possibly damaging 0.85
R7283:Fat4 UTSW 3 38,943,842 (GRCm39) missense probably damaging 1.00
R7296:Fat4 UTSW 3 38,943,294 (GRCm39) nonsense probably null
R7372:Fat4 UTSW 3 38,944,358 (GRCm39) missense probably damaging 1.00
R7400:Fat4 UTSW 3 38,942,073 (GRCm39) missense probably damaging 1.00
R7419:Fat4 UTSW 3 39,054,385 (GRCm39) missense probably damaging 1.00
R7430:Fat4 UTSW 3 39,063,793 (GRCm39) missense probably damaging 1.00
R7430:Fat4 UTSW 3 38,941,599 (GRCm39) missense probably damaging 0.97
R7431:Fat4 UTSW 3 39,063,306 (GRCm39) missense possibly damaging 0.80
R7486:Fat4 UTSW 3 39,011,576 (GRCm39) nonsense probably null
R7501:Fat4 UTSW 3 39,012,597 (GRCm39) nonsense probably null
R7533:Fat4 UTSW 3 39,061,406 (GRCm39) missense probably benign 0.43
R7542:Fat4 UTSW 3 39,035,770 (GRCm39) missense possibly damaging 0.64
R7542:Fat4 UTSW 3 39,035,504 (GRCm39) missense possibly damaging 0.56
R7548:Fat4 UTSW 3 39,035,263 (GRCm39) missense probably benign 0.13
R7567:Fat4 UTSW 3 38,943,485 (GRCm39) missense probably damaging 1.00
R7644:Fat4 UTSW 3 39,064,390 (GRCm39) missense possibly damaging 0.64
R7660:Fat4 UTSW 3 39,035,309 (GRCm39) missense probably benign
R7665:Fat4 UTSW 3 38,943,327 (GRCm39) missense probably benign 0.00
R7676:Fat4 UTSW 3 38,945,846 (GRCm39) missense probably damaging 0.98
R7832:Fat4 UTSW 3 39,055,353 (GRCm39) missense probably benign 0.00
R7848:Fat4 UTSW 3 38,942,000 (GRCm39) missense probably benign
R7883:Fat4 UTSW 3 39,035,968 (GRCm39) missense probably damaging 1.00
R7892:Fat4 UTSW 3 39,003,588 (GRCm39) critical splice acceptor site probably null
R7904:Fat4 UTSW 3 38,941,690 (GRCm39) missense probably damaging 1.00
R7952:Fat4 UTSW 3 38,945,870 (GRCm39) missense probably damaging 0.98
R8015:Fat4 UTSW 3 39,036,065 (GRCm39) missense possibly damaging 0.79
R8040:Fat4 UTSW 3 39,035,815 (GRCm39) missense probably damaging 1.00
R8142:Fat4 UTSW 3 38,945,352 (GRCm39) missense probably damaging 1.00
R8151:Fat4 UTSW 3 38,946,203 (GRCm39) missense probably damaging 0.99
R8163:Fat4 UTSW 3 39,033,881 (GRCm39) missense possibly damaging 0.88
R8317:Fat4 UTSW 3 39,012,659 (GRCm39) missense possibly damaging 0.80
R8413:Fat4 UTSW 3 39,063,128 (GRCm39) critical splice acceptor site probably null
R8447:Fat4 UTSW 3 39,033,824 (GRCm39) missense possibly damaging 0.88
R8458:Fat4 UTSW 3 39,035,702 (GRCm39) missense probably benign 0.25
R8509:Fat4 UTSW 3 39,036,052 (GRCm39) missense probably benign
R8543:Fat4 UTSW 3 39,031,643 (GRCm39) missense probably damaging 1.00
R8679:Fat4 UTSW 3 39,064,842 (GRCm39) missense probably damaging 1.00
R8726:Fat4 UTSW 3 39,064,647 (GRCm39) missense probably damaging 1.00
R8743:Fat4 UTSW 3 38,942,592 (GRCm39) missense probably benign 0.16
R8751:Fat4 UTSW 3 38,946,002 (GRCm39) missense probably benign 0.01
R8779:Fat4 UTSW 3 39,033,898 (GRCm39) missense probably damaging 1.00
R8797:Fat4 UTSW 3 39,053,278 (GRCm39) missense probably benign 0.01
R8860:Fat4 UTSW 3 38,946,269 (GRCm39) missense probably benign 0.26
R8955:Fat4 UTSW 3 39,037,778 (GRCm39) missense probably benign 0.01
R9053:Fat4 UTSW 3 38,941,324 (GRCm39) nonsense probably null
R9071:Fat4 UTSW 3 39,037,598 (GRCm39) missense probably benign 0.29
R9088:Fat4 UTSW 3 39,061,448 (GRCm39) missense probably benign 0.02
R9100:Fat4 UTSW 3 39,064,803 (GRCm39) missense
R9180:Fat4 UTSW 3 38,942,556 (GRCm39) missense possibly damaging 0.78
R9184:Fat4 UTSW 3 39,036,592 (GRCm39) missense probably damaging 0.99
R9201:Fat4 UTSW 3 38,945,079 (GRCm39) missense probably damaging 1.00
R9206:Fat4 UTSW 3 39,063,390 (GRCm39) missense probably damaging 0.99
R9268:Fat4 UTSW 3 38,942,396 (GRCm39) missense probably damaging 1.00
R9278:Fat4 UTSW 3 38,945,171 (GRCm39) missense probably benign 0.44
R9287:Fat4 UTSW 3 38,945,781 (GRCm39) missense probably damaging 0.98
R9355:Fat4 UTSW 3 39,036,047 (GRCm39) missense probably damaging 1.00
R9437:Fat4 UTSW 3 38,945,417 (GRCm39) missense probably benign 0.00
R9455:Fat4 UTSW 3 38,945,412 (GRCm39) missense
R9456:Fat4 UTSW 3 38,942,571 (GRCm39) missense possibly damaging 0.50
R9476:Fat4 UTSW 3 39,037,886 (GRCm39) missense probably benign 0.04
R9510:Fat4 UTSW 3 39,037,886 (GRCm39) missense probably benign 0.04
R9511:Fat4 UTSW 3 39,034,802 (GRCm39) missense probably damaging 0.98
R9540:Fat4 UTSW 3 39,063,346 (GRCm39) missense probably benign
R9568:Fat4 UTSW 3 38,946,156 (GRCm39) missense probably damaging 1.00
R9646:Fat4 UTSW 3 39,035,813 (GRCm39) missense probably damaging 1.00
R9683:Fat4 UTSW 3 38,943,332 (GRCm39) missense possibly damaging 0.52
R9711:Fat4 UTSW 3 39,055,374 (GRCm39) missense probably benign 0.00
X0017:Fat4 UTSW 3 39,063,255 (GRCm39) missense probably benign 0.00
X0019:Fat4 UTSW 3 39,035,189 (GRCm39) missense probably damaging 1.00
X0020:Fat4 UTSW 3 39,054,300 (GRCm39) missense probably damaging 1.00
X0024:Fat4 UTSW 3 38,997,051 (GRCm39) missense probably benign 0.43
X0064:Fat4 UTSW 3 39,024,901 (GRCm39) missense probably damaging 1.00
Z1088:Fat4 UTSW 3 39,012,641 (GRCm39) missense probably benign 0.00
Z1088:Fat4 UTSW 3 38,941,199 (GRCm39) missense possibly damaging 0.88
Z1176:Fat4 UTSW 3 39,037,964 (GRCm39) missense probably damaging 1.00
Z1176:Fat4 UTSW 3 39,037,508 (GRCm39) missense probably benign 0.00
Z1177:Fat4 UTSW 3 38,944,496 (GRCm39) missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38,942,733 (GRCm39) missense probably damaging 1.00
Z1177:Fat4 UTSW 3 39,035,987 (GRCm39) missense probably damaging 1.00
Predicted Primers
Posted On 2015-02-04