Incidental Mutation 'R0812:Ap5z1'
ID 262300
Institutional Source Beutler Lab
Gene Symbol Ap5z1
Ensembl Gene ENSMUSG00000039623
Gene Name adaptor-related protein complex 5, zeta 1 subunit
Synonyms C330006K01Rik
MMRRC Submission 038992-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.232) question?
Stock # R0812 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 142449699-142464465 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 142461546 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 583 (R583H)
Ref Sequence ENSEMBL: ENSMUSP00000143179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038699] [ENSMUST00000196055]
AlphaFold Q3U829
Predicted Effect probably benign
Transcript: ENSMUST00000038699
AA Change: R599H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041863
Gene: ENSMUSG00000039623
AA Change: R599H

DomainStartEndE-ValueType
low complexity region 271 294 N/A INTRINSIC
Pfam:SPG48 319 437 2.9e-45 PFAM
low complexity region 579 584 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196055
AA Change: R583H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000143179
Gene: ENSMUSG00000039623
AA Change: R583H

DomainStartEndE-ValueType
low complexity region 271 294 N/A INTRINSIC
Pfam:SPG48 318 758 2.6e-181 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198135
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.8%
  • 20x: 91.7%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by genome-wide screen for genes involved in homologous recombination DNA double-strand break repair (HR-DSBR). The encoded protein was found in a complex with other proteins that have a role in HR-DSBR. Knockdown of this gene reduced homologous recombination, and mutations in this gene were found in patients with spastic paraplegia. It was concluded that this gene likely encodes a helicase (PMID:20613862). [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,763,229 (GRCm39) S586P probably damaging Het
Abcc3 G A 11: 94,266,028 (GRCm39) probably benign Het
Arrb1 G T 7: 99,247,708 (GRCm39) V346L probably benign Het
Atrnl1 T A 19: 57,661,573 (GRCm39) F518I probably benign Het
Bank1 T A 3: 135,799,127 (GRCm39) I405F probably damaging Het
Cacna1c A G 6: 118,607,224 (GRCm39) C1227R probably benign Het
Cacna1h A G 17: 25,607,602 (GRCm39) L905P probably damaging Het
Cc2d1a A G 8: 84,860,465 (GRCm39) Y826H probably benign Het
Cenpo A G 12: 4,266,643 (GRCm39) V155A probably benign Het
Cnmd A G 14: 79,898,863 (GRCm39) F63S probably damaging Het
Cnn3 G A 3: 121,248,600 (GRCm39) G72D probably damaging Het
Cox10 A G 11: 63,962,539 (GRCm39) S101P probably benign Het
Ctdsp1 T C 1: 74,433,806 (GRCm39) V129A probably damaging Het
Cyp2d34 A T 15: 82,502,807 (GRCm39) S140T probably benign Het
Dennd5a G A 7: 109,532,820 (GRCm39) H317Y possibly damaging Het
Dnaaf9 A G 2: 130,555,334 (GRCm39) F858S probably damaging Het
Eef2 C CN 10: 81,014,603 (GRCm39) probably null Het
Enox1 T A 14: 77,819,876 (GRCm39) D210E probably damaging Het
Fam171a1 A G 2: 3,198,464 (GRCm39) N190S probably damaging Het
Fat2 T A 11: 55,144,459 (GRCm39) K4138N possibly damaging Het
Fat4 A T 3: 39,011,623 (GRCm39) D2241V probably damaging Het
Fbn1 C T 2: 125,245,090 (GRCm39) V266I possibly damaging Het
Foxf2 T A 13: 31,811,188 (GRCm39) Y376N probably damaging Het
Fras1 T A 5: 96,900,857 (GRCm39) S3025R probably benign Het
Gba1 T C 3: 89,111,307 (GRCm39) I24T probably benign Het
Gdpd5 A G 7: 99,087,540 (GRCm39) D68G probably damaging Het
Grid1 G A 14: 34,544,576 (GRCm39) S49N probably benign Het
Grtp1 T C 8: 13,229,639 (GRCm39) T250A possibly damaging Het
Gucy1b1 T C 3: 81,945,295 (GRCm39) N448D probably benign Het
H2-Ob A G 17: 34,463,100 (GRCm39) probably benign Het
Hcn4 A G 9: 58,730,795 (GRCm39) M1V probably null Het
Hmcn2 G A 2: 31,310,383 (GRCm39) A3326T probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,078,302 (GRCm39) probably benign Het
Ippk C A 13: 49,596,947 (GRCm39) Q254K probably damaging Het
Itga2 A T 13: 115,007,150 (GRCm39) L393I possibly damaging Het
Kcna10 A T 3: 107,102,575 (GRCm39) E402V possibly damaging Het
Kcnab1 G A 3: 65,205,141 (GRCm39) D119N probably damaging Het
Kcnip4 T A 5: 48,567,202 (GRCm39) T122S probably benign Het
Kcnma1 G A 14: 23,350,086 (GRCm39) P1151L probably damaging Het
Klhl22 T A 16: 17,610,453 (GRCm39) M568K probably benign Het
Krt6a C T 15: 101,601,183 (GRCm39) V257M probably damaging Het
Ksr2 A C 5: 117,693,290 (GRCm39) H246P probably damaging Het
Lca5 T C 9: 83,281,806 (GRCm39) D326G possibly damaging Het
Lcp1 A G 14: 75,451,928 (GRCm39) E393G probably benign Het
Leo1 G A 9: 75,352,831 (GRCm39) E125K probably benign Het
Lipt1 T A 1: 37,914,382 (GRCm39) V146E probably damaging Het
Mael A T 1: 166,062,968 (GRCm39) probably null Het
Mga C T 2: 119,778,442 (GRCm39) L1996F probably damaging Het
Mllt6 A G 11: 97,569,387 (GRCm39) N913S probably damaging Het
Mphosph9 A C 5: 124,436,822 (GRCm39) D507E probably damaging Het
Mvp G A 7: 126,586,728 (GRCm39) A801V probably benign Het
Ndrg2 A G 14: 52,146,119 (GRCm39) probably benign Het
Neb T C 2: 52,182,707 (GRCm39) D1053G possibly damaging Het
Nubp1 C A 16: 10,231,585 (GRCm39) L79I probably benign Het
Or1e1f G A 11: 73,856,246 (GRCm39) E271K probably benign Het
Or1o2 A C 17: 37,543,223 (GRCm39) L13V probably benign Het
Or8d2 G A 9: 38,759,805 (GRCm39) V132I probably benign Het
Pnpla8 G A 12: 44,330,188 (GRCm39) V29M probably benign Het
Psmb2 T A 4: 126,601,350 (GRCm39) I151N possibly damaging Het
Ptgs2 C T 1: 149,977,105 (GRCm39) T104I probably benign Het
Ptpro A G 6: 137,345,077 (GRCm39) T28A probably benign Het
Raf1 A G 6: 115,603,671 (GRCm39) probably null Het
Ranbp2 T C 10: 58,301,351 (GRCm39) M668T probably benign Het
Rbm48 A T 5: 3,641,760 (GRCm39) probably null Het
Rhag A T 17: 41,142,469 (GRCm39) T225S possibly damaging Het
Rhof A C 5: 123,269,950 (GRCm39) L69R probably damaging Het
Slc24a5 T C 2: 124,910,724 (GRCm39) S52P probably damaging Het
Slc8a2 T C 7: 15,875,039 (GRCm39) V429A probably damaging Het
Slfn10-ps G A 11: 82,926,388 (GRCm39) noncoding transcript Het
Spam1 G A 6: 24,796,886 (GRCm39) R279H probably damaging Het
Srfbp1 A G 18: 52,620,588 (GRCm39) D102G probably damaging Het
Srrm3 A C 5: 135,902,136 (GRCm39) probably benign Het
Tk1 T C 11: 117,712,933 (GRCm39) E98G probably damaging Het
Trim13 G A 14: 61,843,149 (GRCm39) V389I probably benign Het
Ttc28 A T 5: 111,383,366 (GRCm39) Y1289F probably benign Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Ugt1a10 T A 1: 87,983,904 (GRCm39) V234D probably benign Het
Vmn2r18 C A 5: 151,496,395 (GRCm39) probably benign Het
Vmn2r75 C T 7: 85,814,575 (GRCm39) G306E probably benign Het
Vmn2r86 C T 10: 130,289,497 (GRCm39) V133I probably benign Het
Vps13c C A 9: 67,841,758 (GRCm39) Q1927K probably benign Het
Zbtb14 C A 17: 69,695,497 (GRCm39) F398L probably damaging Het
Zfp219 T A 14: 52,244,395 (GRCm39) T550S probably benign Het
Zfp329 T A 7: 12,545,395 (GRCm39) N43I probably benign Het
Zfp507 G A 7: 35,502,048 (GRCm39) probably benign Het
Zfp97 T A 17: 17,365,552 (GRCm39) F350L possibly damaging Het
Other mutations in Ap5z1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Ap5z1 APN 5 142,458,006 (GRCm39) missense probably benign 0.02
IGL01456:Ap5z1 APN 5 142,453,791 (GRCm39) missense probably damaging 0.96
IGL01656:Ap5z1 APN 5 142,456,069 (GRCm39) missense probably benign 0.10
IGL02079:Ap5z1 APN 5 142,462,868 (GRCm39) critical splice donor site probably null
IGL02134:Ap5z1 APN 5 142,460,214 (GRCm39) missense probably benign 0.09
IGL02662:Ap5z1 APN 5 142,462,644 (GRCm39) splice site probably null
IGL02805:Ap5z1 APN 5 142,456,038 (GRCm39) unclassified probably benign
R0057:Ap5z1 UTSW 5 142,456,144 (GRCm39) unclassified probably benign
R0057:Ap5z1 UTSW 5 142,456,144 (GRCm39) unclassified probably benign
R0094:Ap5z1 UTSW 5 142,462,567 (GRCm39) missense probably benign 0.00
R0395:Ap5z1 UTSW 5 142,456,317 (GRCm39) unclassified probably benign
R0811:Ap5z1 UTSW 5 142,461,546 (GRCm39) missense probably benign 0.00
R1241:Ap5z1 UTSW 5 142,455,869 (GRCm39) missense probably damaging 1.00
R1248:Ap5z1 UTSW 5 142,460,255 (GRCm39) missense probably benign 0.02
R1374:Ap5z1 UTSW 5 142,456,213 (GRCm39) missense probably damaging 1.00
R1616:Ap5z1 UTSW 5 142,457,991 (GRCm39) missense probably benign 0.10
R1923:Ap5z1 UTSW 5 142,458,096 (GRCm39) missense probably benign 0.30
R2423:Ap5z1 UTSW 5 142,462,532 (GRCm39) missense probably benign 0.02
R3790:Ap5z1 UTSW 5 142,456,168 (GRCm39) missense probably benign
R4859:Ap5z1 UTSW 5 142,459,748 (GRCm39) missense possibly damaging 0.75
R4965:Ap5z1 UTSW 5 142,453,431 (GRCm39) missense probably damaging 1.00
R5147:Ap5z1 UTSW 5 142,452,265 (GRCm39) missense probably benign 0.02
R5311:Ap5z1 UTSW 5 142,453,442 (GRCm39) missense possibly damaging 0.79
R5531:Ap5z1 UTSW 5 142,453,536 (GRCm39) missense probably benign
R5569:Ap5z1 UTSW 5 142,460,206 (GRCm39) missense probably damaging 0.99
R5725:Ap5z1 UTSW 5 142,454,731 (GRCm39) missense probably damaging 1.00
R7287:Ap5z1 UTSW 5 142,459,802 (GRCm39) missense probably damaging 0.99
R7407:Ap5z1 UTSW 5 142,452,330 (GRCm39) missense probably benign 0.06
R7537:Ap5z1 UTSW 5 142,463,053 (GRCm39) missense probably benign 0.06
R7894:Ap5z1 UTSW 5 142,456,191 (GRCm39) nonsense probably null
R7894:Ap5z1 UTSW 5 142,452,039 (GRCm39) missense probably benign 0.34
R7895:Ap5z1 UTSW 5 142,456,313 (GRCm39) critical splice donor site probably null
R8022:Ap5z1 UTSW 5 142,455,904 (GRCm39) critical splice donor site probably null
R8244:Ap5z1 UTSW 5 142,459,735 (GRCm39) missense possibly damaging 0.60
R8823:Ap5z1 UTSW 5 142,460,191 (GRCm39) missense probably benign 0.19
R8867:Ap5z1 UTSW 5 142,463,011 (GRCm39) missense probably benign 0.05
R9673:Ap5z1 UTSW 5 142,463,113 (GRCm39) missense probably benign 0.32
Predicted Primers
Posted On 2015-02-04