Mutagenetix > Incidental Mutations

Incidental Mutation 'R0811:Kcnab1'

262329

Institutional Source

Beutler Lab

Gene Symbol

Kcnab1

Ensembl Gene

ENSMUSG00000027827

Gene Name

potassium voltage-gated channel, shaker-related subfamily, beta member 1

Synonyms

Kvbeta1.1, mKv(beta)1, Akr8a8

MMRRC Submission

038991-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R0811 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65109384-65378223 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 65297720 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 119 (D119N)

Ref Sequence

ENSEMBL: ENSMUSP00000047480 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049230]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049230
AA Change: D119N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000047480
Gene: ENSMUSG00000027827
AA Change: D119N

Domain	Start	End	E-Value	Type
Pfam:Aldo_ket_red	85	390	1.8e-73	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159525

SMART Domains

Protein: ENSMUSP00000124311
Gene: ENSMUSG00000027827

Domain	Start	End	E-Value	Type
Pfam:Aldo_ket_red	85	343	1.3e-60	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160136

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161404

SMART Domains

Protein: ENSMUSP00000125578
Gene: ENSMUSG00000027827

Domain	Start	End	E-Value	Type
Pfam:Aldo_ket_red	1	284	4e-68	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161979

SMART Domains

Protein: ENSMUSP00000125050
Gene: ENSMUSG00000027827

Domain	Start	End	E-Value	Type
Pfam:Aldo_ket_red	50	355	1.2e-73	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195489

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195685

Meta Mutation Damage Score

0.9478

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.3%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member includes distinct isoforms which are encoded by alternatively spliced transcript variants of this gene. Some of these isoforms are beta subunits, which form heteromultimeric complexes with alpha subunits and modulate the activity of the pore-forming alpha subunits. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some learning defects but are otherwise normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	A	G	2: 130,713,414	F858S	probably damaging	Het
Abcb1a	T	C	5: 8,713,229	S586P	probably damaging	Het
Ap5z1	G	A	5: 142,475,791	R583H	probably benign	Het
Arhgap28	TCAGCAGCAGCAGCAGCAGCAG	TCAGCAGCAGCAGCAGCAG	17: 67,901,299		probably benign	Het
Arrb1	G	T	7: 99,598,501	V346L	probably benign	Het
Atrnl1	T	A	19: 57,673,141	F518I	probably benign	Het
Bank1	T	A	3: 136,093,366	I405F	probably damaging	Het
Cacna1h	A	G	17: 25,388,628	L905P	probably damaging	Het
Cc2d1a	A	G	8: 84,133,836	Y826H	probably benign	Het
Cenpo	A	G	12: 4,216,643	V155A	probably benign	Het
Cnmd	A	G	14: 79,661,423	F63S	probably damaging	Het
Cnn3	G	A	3: 121,454,951	G72D	probably damaging	Het
Cox10	A	G	11: 64,071,713	S101P	probably benign	Het
Ctdsp1	T	C	1: 74,394,647	V129A	probably damaging	Het
Cyp2d34	A	T	15: 82,618,606	S140T	probably benign	Het
Dennd5a	G	A	7: 109,933,613	H317Y	possibly damaging	Het
Eef2	C	CN	10: 81,178,769		probably null	Het
Enox1	T	A	14: 77,582,436	D210E	probably damaging	Het
Fam171a1	A	G	2: 3,197,427	N190S	probably damaging	Het
Fat2	T	A	11: 55,253,633	K4138N	possibly damaging	Het
Fat4	A	T	3: 38,957,474	D2241V	probably damaging	Het
Fbn1	C	T	2: 125,403,170	V266I	possibly damaging	Het
Fras1	T	A	5: 96,752,998	S3025R	probably benign	Het
Gba	T	C	3: 89,204,000	I24T	probably benign	Het
Gdpd5	A	G	7: 99,438,333	D68G	probably damaging	Het
Grid1	G	A	14: 34,822,619	S49N	probably benign	Het
Grtp1	T	C	8: 13,179,639	T250A	possibly damaging	Het
Gucy1b1	T	C	3: 82,037,988	N448D	probably benign	Het
Hmcn2	G	A	2: 31,420,371	A3326T	probably damaging	Het
Ippk	C	A	13: 49,443,471	Q254K	probably damaging	Het
Itga2	A	T	13: 114,870,614	L393I	possibly damaging	Het
Kcna10	A	T	3: 107,195,259	E402V	possibly damaging	Het
Kcnip4	T	A	5: 48,409,860	T122S	probably benign	Het
Kcnma1	G	A	14: 23,300,018	P1151L	probably damaging	Het
Klhl22	T	A	16: 17,792,589	M568K	probably benign	Het
Krt6a	C	T	15: 101,692,748	V257M	probably damaging	Het
Ksr2	A	C	5: 117,555,225	H246P	probably damaging	Het
Lca5	T	C	9: 83,399,753	D326G	possibly damaging	Het
Lcp1	A	G	14: 75,214,488	E393G	probably benign	Het
Leo1	G	A	9: 75,445,549	E125K	probably benign	Het
Lipt1	T	A	1: 37,875,301	V146E	probably damaging	Het
Mael	A	T	1: 166,235,399		probably null	Het
Mga	C	T	2: 119,947,961	L1996F	probably damaging	Het
Mllt6	A	G	11: 97,678,561	N913S	probably damaging	Het
Mphosph9	A	C	5: 124,298,759	D507E	probably damaging	Het
Mvp	G	A	7: 126,987,556	A801V	probably benign	Het
Neb	T	C	2: 52,292,695	D1053G	possibly damaging	Het
Nubp1	C	A	16: 10,413,721	L79I	probably benign	Het
Olfr397	G	A	11: 73,965,420	E271K	probably benign	Het
Olfr924	G	A	9: 38,848,509	V132I	probably benign	Het
Olfr97	A	C	17: 37,232,332	L13V	probably benign	Het
Pithd1	A	G	4: 135,977,134		probably benign	Het
Pnpla8	G	A	12: 44,283,405	V29M	probably benign	Het
Psmb2	T	A	4: 126,707,557	I151N	possibly damaging	Het
Ptgs2	C	T	1: 150,101,354	T104I	probably benign	Het
Ptpro	A	G	6: 137,368,079	T28A	probably benign	Het
Raf1	A	G	6: 115,626,710		probably null	Het
Ranbp2	T	C	10: 58,465,529	M668T	probably benign	Het
Rbm48	A	T	5: 3,591,760		probably null	Het
Rhag	A	T	17: 40,831,578	T225S	possibly damaging	Het
Rhof	A	C	5: 123,131,887	L69R	probably damaging	Het
Slc22a1	T	C	17: 12,666,618		probably benign	Het
Slc24a5	T	C	2: 125,068,804	S52P	probably damaging	Het
Slc8a2	T	C	7: 16,141,114	V429A	probably damaging	Het
Spam1	G	A	6: 24,796,887	R279H	probably damaging	Het
Spata16	T	A	3: 26,913,338		probably benign	Het
Srfbp1	A	G	18: 52,487,516	D102G	probably damaging	Het
Srrm3	A	C	5: 135,873,282		probably benign	Het
Tbl1xr1	T	A	3: 22,200,587		probably benign	Het
Tk1	T	C	11: 117,822,107	E98G	probably damaging	Het
Trim13	G	A	14: 61,605,700	V389I	probably benign	Het
Ttc28	A	T	5: 111,235,500	Y1289F	probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ugt1a10	T	A	1: 88,056,182	V234D	probably benign	Het
Vmn2r75	C	T	7: 86,165,367	G306E	probably benign	Het
Vmn2r86	C	T	10: 130,453,628	V133I	probably benign	Het
Vps13c	C	A	9: 67,934,476	Q1927K	probably benign	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp219	T	A	14: 52,006,938	T550S	probably benign	Het
Zfp329	T	A	7: 12,811,468	N43I	probably benign	Het

Other mutations in Kcnab1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01819:Kcnab1	APN	3	65319454	missense	probably damaging	1.00
IGL01936:Kcnab1	APN	3	65358274	missense	probably damaging	1.00
IGL02291:Kcnab1	APN	3	65357082	missense	possibly damaging	0.94
IGL02425:Kcnab1	APN	3	65302179	missense	possibly damaging	0.59
PIT4418001:Kcnab1	UTSW	3	65358320	missense	probably benign	0.12
R0017:Kcnab1	UTSW	3	65357106	missense	probably damaging	0.98
R0017:Kcnab1	UTSW	3	65357106	missense	probably damaging	0.98
R0812:Kcnab1	UTSW	3	65297720	missense	probably damaging	1.00
R1847:Kcnab1	UTSW	3	65302194	critical splice donor site	probably null
R1926:Kcnab1	UTSW	3	65376512	missense	possibly damaging	0.73
R2064:Kcnab1	UTSW	3	65364639	missense	probably benign	0.07
R2152:Kcnab1	UTSW	3	65371440	missense	probably damaging	0.99
R2153:Kcnab1	UTSW	3	65371440	missense	probably damaging	0.99
R2197:Kcnab1	UTSW	3	65109947	missense	probably benign	0.00
R2233:Kcnab1	UTSW	3	65319467	missense	probably damaging	1.00
R2235:Kcnab1	UTSW	3	65319467	missense	probably damaging	1.00
R2437:Kcnab1	UTSW	3	65357014	splice site	probably benign
R3916:Kcnab1	UTSW	3	65304164	critical splice donor site	probably null
R4093:Kcnab1	UTSW	3	65299614	missense	possibly damaging	0.96
R4347:Kcnab1	UTSW	3	65297475	intron	probably benign
R4796:Kcnab1	UTSW	3	65304165	critical splice donor site	probably null
R5588:Kcnab1	UTSW	3	65376555	missense	possibly damaging	0.59
R7254:Kcnab1	UTSW	3	65319487	missense	probably benign	0.08
R7347:Kcnab1	UTSW	3	65376531	missense	probably benign	0.07
R7424:Kcnab1	UTSW	3	65266503	missense	possibly damaging	0.80
Z1177:Kcnab1	UTSW	3	65266510	missense	probably damaging	0.99
Z1177:Kcnab1	UTSW	3	65357133	missense	probably benign	0.08

Predicted Primers

Posted On

2015-02-04