Incidental Mutation 'R0811:Kcnab1'
ID 262329
Institutional Source Beutler Lab
Gene Symbol Kcnab1
Ensembl Gene ENSMUSG00000027827
Gene Name potassium voltage-gated channel, shaker-related subfamily, beta member 1
Synonyms mKv(beta)1, Akr8a8, Kvbeta1.1
MMRRC Submission 038991-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R0811 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 64856636-65285643 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 65205141 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 119 (D119N)
Ref Sequence ENSEMBL: ENSMUSP00000047480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049230]
AlphaFold P63143
Predicted Effect probably damaging
Transcript: ENSMUST00000049230
AA Change: D119N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047480
Gene: ENSMUSG00000027827
AA Change: D119N

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 85 390 1.8e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159525
SMART Domains Protein: ENSMUSP00000124311
Gene: ENSMUSG00000027827

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 85 343 1.3e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161404
SMART Domains Protein: ENSMUSP00000125578
Gene: ENSMUSG00000027827

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 1 284 4e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161979
SMART Domains Protein: ENSMUSP00000125050
Gene: ENSMUSG00000027827

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 50 355 1.2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195685
Meta Mutation Damage Score 0.9478 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member includes distinct isoforms which are encoded by alternatively spliced transcript variants of this gene. Some of these isoforms are beta subunits, which form heteromultimeric complexes with alpha subunits and modulate the activity of the pore-forming alpha subunits. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some learning defects but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,763,229 (GRCm39) S586P probably damaging Het
Ap5z1 G A 5: 142,461,546 (GRCm39) R583H probably benign Het
Arhgap28 TCAGCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAGCAG 17: 68,208,294 (GRCm39) probably benign Het
Arrb1 G T 7: 99,247,708 (GRCm39) V346L probably benign Het
Atrnl1 T A 19: 57,661,573 (GRCm39) F518I probably benign Het
Bank1 T A 3: 135,799,127 (GRCm39) I405F probably damaging Het
Cacna1h A G 17: 25,607,602 (GRCm39) L905P probably damaging Het
Cc2d1a A G 8: 84,860,465 (GRCm39) Y826H probably benign Het
Cenpo A G 12: 4,266,643 (GRCm39) V155A probably benign Het
Cnmd A G 14: 79,898,863 (GRCm39) F63S probably damaging Het
Cnn3 G A 3: 121,248,600 (GRCm39) G72D probably damaging Het
Cox10 A G 11: 63,962,539 (GRCm39) S101P probably benign Het
Ctdsp1 T C 1: 74,433,806 (GRCm39) V129A probably damaging Het
Cyp2d34 A T 15: 82,502,807 (GRCm39) S140T probably benign Het
Dennd5a G A 7: 109,532,820 (GRCm39) H317Y possibly damaging Het
Dnaaf9 A G 2: 130,555,334 (GRCm39) F858S probably damaging Het
Eef2 C CN 10: 81,014,603 (GRCm39) probably null Het
Enox1 T A 14: 77,819,876 (GRCm39) D210E probably damaging Het
Fam171a1 A G 2: 3,198,464 (GRCm39) N190S probably damaging Het
Fat2 T A 11: 55,144,459 (GRCm39) K4138N possibly damaging Het
Fat4 A T 3: 39,011,623 (GRCm39) D2241V probably damaging Het
Fbn1 C T 2: 125,245,090 (GRCm39) V266I possibly damaging Het
Fras1 T A 5: 96,900,857 (GRCm39) S3025R probably benign Het
Gba1 T C 3: 89,111,307 (GRCm39) I24T probably benign Het
Gdpd5 A G 7: 99,087,540 (GRCm39) D68G probably damaging Het
Grid1 G A 14: 34,544,576 (GRCm39) S49N probably benign Het
Grtp1 T C 8: 13,229,639 (GRCm39) T250A possibly damaging Het
Gucy1b1 T C 3: 81,945,295 (GRCm39) N448D probably benign Het
Hmcn2 G A 2: 31,310,383 (GRCm39) A3326T probably damaging Het
Ippk C A 13: 49,596,947 (GRCm39) Q254K probably damaging Het
Itga2 A T 13: 115,007,150 (GRCm39) L393I possibly damaging Het
Kcna10 A T 3: 107,102,575 (GRCm39) E402V possibly damaging Het
Kcnip4 T A 5: 48,567,202 (GRCm39) T122S probably benign Het
Kcnma1 G A 14: 23,350,086 (GRCm39) P1151L probably damaging Het
Klhl22 T A 16: 17,610,453 (GRCm39) M568K probably benign Het
Krt6a C T 15: 101,601,183 (GRCm39) V257M probably damaging Het
Ksr2 A C 5: 117,693,290 (GRCm39) H246P probably damaging Het
Lca5 T C 9: 83,281,806 (GRCm39) D326G possibly damaging Het
Lcp1 A G 14: 75,451,928 (GRCm39) E393G probably benign Het
Leo1 G A 9: 75,352,831 (GRCm39) E125K probably benign Het
Lipt1 T A 1: 37,914,382 (GRCm39) V146E probably damaging Het
Mael A T 1: 166,062,968 (GRCm39) probably null Het
Mga C T 2: 119,778,442 (GRCm39) L1996F probably damaging Het
Mllt6 A G 11: 97,569,387 (GRCm39) N913S probably damaging Het
Mphosph9 A C 5: 124,436,822 (GRCm39) D507E probably damaging Het
Mvp G A 7: 126,586,728 (GRCm39) A801V probably benign Het
Neb T C 2: 52,182,707 (GRCm39) D1053G possibly damaging Het
Nubp1 C A 16: 10,231,585 (GRCm39) L79I probably benign Het
Or1e1f G A 11: 73,856,246 (GRCm39) E271K probably benign Het
Or1o2 A C 17: 37,543,223 (GRCm39) L13V probably benign Het
Or8d2 G A 9: 38,759,805 (GRCm39) V132I probably benign Het
Pithd1 A G 4: 135,704,445 (GRCm39) probably benign Het
Pnpla8 G A 12: 44,330,188 (GRCm39) V29M probably benign Het
Psmb2 T A 4: 126,601,350 (GRCm39) I151N possibly damaging Het
Ptgs2 C T 1: 149,977,105 (GRCm39) T104I probably benign Het
Ptpro A G 6: 137,345,077 (GRCm39) T28A probably benign Het
Raf1 A G 6: 115,603,671 (GRCm39) probably null Het
Ranbp2 T C 10: 58,301,351 (GRCm39) M668T probably benign Het
Rbm48 A T 5: 3,641,760 (GRCm39) probably null Het
Rhag A T 17: 41,142,469 (GRCm39) T225S possibly damaging Het
Rhof A C 5: 123,269,950 (GRCm39) L69R probably damaging Het
Slc22a1 T C 17: 12,885,505 (GRCm39) probably benign Het
Slc24a5 T C 2: 124,910,724 (GRCm39) S52P probably damaging Het
Slc8a2 T C 7: 15,875,039 (GRCm39) V429A probably damaging Het
Spam1 G A 6: 24,796,886 (GRCm39) R279H probably damaging Het
Spata16 T A 3: 26,967,487 (GRCm39) probably benign Het
Srfbp1 A G 18: 52,620,588 (GRCm39) D102G probably damaging Het
Srrm3 A C 5: 135,902,136 (GRCm39) probably benign Het
Tbl1xr1 T A 3: 22,254,751 (GRCm39) probably benign Het
Tk1 T C 11: 117,712,933 (GRCm39) E98G probably damaging Het
Trim13 G A 14: 61,843,149 (GRCm39) V389I probably benign Het
Ttc28 A T 5: 111,383,366 (GRCm39) Y1289F probably benign Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Ugt1a10 T A 1: 87,983,904 (GRCm39) V234D probably benign Het
Vmn2r75 C T 7: 85,814,575 (GRCm39) G306E probably benign Het
Vmn2r86 C T 10: 130,289,497 (GRCm39) V133I probably benign Het
Vps13c C A 9: 67,841,758 (GRCm39) Q1927K probably benign Het
Zbtb14 C A 17: 69,695,497 (GRCm39) F398L probably damaging Het
Zfp219 T A 14: 52,244,395 (GRCm39) T550S probably benign Het
Zfp329 T A 7: 12,545,395 (GRCm39) N43I probably benign Het
Other mutations in Kcnab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01819:Kcnab1 APN 3 65,226,875 (GRCm39) missense probably damaging 1.00
IGL01936:Kcnab1 APN 3 65,265,695 (GRCm39) missense probably damaging 1.00
IGL02291:Kcnab1 APN 3 65,264,503 (GRCm39) missense possibly damaging 0.94
IGL02425:Kcnab1 APN 3 65,209,600 (GRCm39) missense possibly damaging 0.59
PIT4418001:Kcnab1 UTSW 3 65,265,741 (GRCm39) missense probably benign 0.12
R0017:Kcnab1 UTSW 3 65,264,527 (GRCm39) missense probably damaging 0.98
R0017:Kcnab1 UTSW 3 65,264,527 (GRCm39) missense probably damaging 0.98
R0812:Kcnab1 UTSW 3 65,205,141 (GRCm39) missense probably damaging 1.00
R1847:Kcnab1 UTSW 3 65,209,615 (GRCm39) critical splice donor site probably null
R1926:Kcnab1 UTSW 3 65,283,933 (GRCm39) missense possibly damaging 0.73
R2064:Kcnab1 UTSW 3 65,272,060 (GRCm39) missense probably benign 0.07
R2152:Kcnab1 UTSW 3 65,278,861 (GRCm39) missense probably damaging 0.99
R2153:Kcnab1 UTSW 3 65,278,861 (GRCm39) missense probably damaging 0.99
R2197:Kcnab1 UTSW 3 65,017,368 (GRCm39) missense probably benign 0.00
R2233:Kcnab1 UTSW 3 65,226,888 (GRCm39) missense probably damaging 1.00
R2235:Kcnab1 UTSW 3 65,226,888 (GRCm39) missense probably damaging 1.00
R2437:Kcnab1 UTSW 3 65,264,435 (GRCm39) splice site probably benign
R3916:Kcnab1 UTSW 3 65,211,585 (GRCm39) critical splice donor site probably null
R4093:Kcnab1 UTSW 3 65,207,035 (GRCm39) missense possibly damaging 0.96
R4347:Kcnab1 UTSW 3 65,204,896 (GRCm39) intron probably benign
R4796:Kcnab1 UTSW 3 65,211,586 (GRCm39) critical splice donor site probably null
R5588:Kcnab1 UTSW 3 65,283,976 (GRCm39) missense possibly damaging 0.59
R7254:Kcnab1 UTSW 3 65,226,908 (GRCm39) missense probably benign 0.08
R7347:Kcnab1 UTSW 3 65,283,952 (GRCm39) missense probably benign 0.07
R7424:Kcnab1 UTSW 3 65,173,924 (GRCm39) missense possibly damaging 0.80
Z1177:Kcnab1 UTSW 3 65,264,554 (GRCm39) missense probably benign 0.08
Z1177:Kcnab1 UTSW 3 65,173,931 (GRCm39) missense probably damaging 0.99
Predicted Primers
Posted On 2015-02-04