Incidental Mutation 'R0811:Kcnab1'
Institutional Source Beutler Lab
Gene Symbol Kcnab1
Ensembl Gene ENSMUSG00000027827
Gene Namepotassium voltage-gated channel, shaker-related subfamily, beta member 1
SynonymsKvbeta1.1, mKv(beta)1, Akr8a8
MMRRC Submission 038991-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R0811 (G1)
Quality Score225
Status Not validated
Chromosomal Location65109384-65378223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65297720 bp
Amino Acid Change Aspartic acid to Asparagine at position 119 (D119N)
Ref Sequence ENSEMBL: ENSMUSP00000047480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049230]
Predicted Effect probably damaging
Transcript: ENSMUST00000049230
AA Change: D119N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047480
Gene: ENSMUSG00000027827
AA Change: D119N

Pfam:Aldo_ket_red 85 390 1.8e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159525
SMART Domains Protein: ENSMUSP00000124311
Gene: ENSMUSG00000027827

Pfam:Aldo_ket_red 85 343 1.3e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161404
SMART Domains Protein: ENSMUSP00000125578
Gene: ENSMUSG00000027827

Pfam:Aldo_ket_red 1 284 4e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161979
SMART Domains Protein: ENSMUSP00000125050
Gene: ENSMUSG00000027827

Pfam:Aldo_ket_red 50 355 1.2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195685
Meta Mutation Damage Score 0.9478 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member includes distinct isoforms which are encoded by alternatively spliced transcript variants of this gene. Some of these isoforms are beta subunits, which form heteromultimeric complexes with alpha subunits and modulate the activity of the pore-forming alpha subunits. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some learning defects but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,713,414 F858S probably damaging Het
Abcb1a T C 5: 8,713,229 S586P probably damaging Het
Ap5z1 G A 5: 142,475,791 R583H probably benign Het
Arhgap28 TCAGCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAGCAG 17: 67,901,299 probably benign Het
Arrb1 G T 7: 99,598,501 V346L probably benign Het
Atrnl1 T A 19: 57,673,141 F518I probably benign Het
Bank1 T A 3: 136,093,366 I405F probably damaging Het
Cacna1h A G 17: 25,388,628 L905P probably damaging Het
Cc2d1a A G 8: 84,133,836 Y826H probably benign Het
Cenpo A G 12: 4,216,643 V155A probably benign Het
Cnmd A G 14: 79,661,423 F63S probably damaging Het
Cnn3 G A 3: 121,454,951 G72D probably damaging Het
Cox10 A G 11: 64,071,713 S101P probably benign Het
Ctdsp1 T C 1: 74,394,647 V129A probably damaging Het
Cyp2d34 A T 15: 82,618,606 S140T probably benign Het
Dennd5a G A 7: 109,933,613 H317Y possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Enox1 T A 14: 77,582,436 D210E probably damaging Het
Fam171a1 A G 2: 3,197,427 N190S probably damaging Het
Fat2 T A 11: 55,253,633 K4138N possibly damaging Het
Fat4 A T 3: 38,957,474 D2241V probably damaging Het
Fbn1 C T 2: 125,403,170 V266I possibly damaging Het
Fras1 T A 5: 96,752,998 S3025R probably benign Het
Gba T C 3: 89,204,000 I24T probably benign Het
Gdpd5 A G 7: 99,438,333 D68G probably damaging Het
Grid1 G A 14: 34,822,619 S49N probably benign Het
Grtp1 T C 8: 13,179,639 T250A possibly damaging Het
Gucy1b1 T C 3: 82,037,988 N448D probably benign Het
Hmcn2 G A 2: 31,420,371 A3326T probably damaging Het
Ippk C A 13: 49,443,471 Q254K probably damaging Het
Itga2 A T 13: 114,870,614 L393I possibly damaging Het
Kcna10 A T 3: 107,195,259 E402V possibly damaging Het
Kcnip4 T A 5: 48,409,860 T122S probably benign Het
Kcnma1 G A 14: 23,300,018 P1151L probably damaging Het
Klhl22 T A 16: 17,792,589 M568K probably benign Het
Krt6a C T 15: 101,692,748 V257M probably damaging Het
Ksr2 A C 5: 117,555,225 H246P probably damaging Het
Lca5 T C 9: 83,399,753 D326G possibly damaging Het
Lcp1 A G 14: 75,214,488 E393G probably benign Het
Leo1 G A 9: 75,445,549 E125K probably benign Het
Lipt1 T A 1: 37,875,301 V146E probably damaging Het
Mael A T 1: 166,235,399 probably null Het
Mga C T 2: 119,947,961 L1996F probably damaging Het
Mllt6 A G 11: 97,678,561 N913S probably damaging Het
Mphosph9 A C 5: 124,298,759 D507E probably damaging Het
Mvp G A 7: 126,987,556 A801V probably benign Het
Neb T C 2: 52,292,695 D1053G possibly damaging Het
Nubp1 C A 16: 10,413,721 L79I probably benign Het
Olfr397 G A 11: 73,965,420 E271K probably benign Het
Olfr924 G A 9: 38,848,509 V132I probably benign Het
Olfr97 A C 17: 37,232,332 L13V probably benign Het
Pithd1 A G 4: 135,977,134 probably benign Het
Pnpla8 G A 12: 44,283,405 V29M probably benign Het
Psmb2 T A 4: 126,707,557 I151N possibly damaging Het
Ptgs2 C T 1: 150,101,354 T104I probably benign Het
Ptpro A G 6: 137,368,079 T28A probably benign Het
Raf1 A G 6: 115,626,710 probably null Het
Ranbp2 T C 10: 58,465,529 M668T probably benign Het
Rbm48 A T 5: 3,591,760 probably null Het
Rhag A T 17: 40,831,578 T225S possibly damaging Het
Rhof A C 5: 123,131,887 L69R probably damaging Het
Slc22a1 T C 17: 12,666,618 probably benign Het
Slc24a5 T C 2: 125,068,804 S52P probably damaging Het
Slc8a2 T C 7: 16,141,114 V429A probably damaging Het
Spam1 G A 6: 24,796,887 R279H probably damaging Het
Spata16 T A 3: 26,913,338 probably benign Het
Srfbp1 A G 18: 52,487,516 D102G probably damaging Het
Srrm3 A C 5: 135,873,282 probably benign Het
Tbl1xr1 T A 3: 22,200,587 probably benign Het
Tk1 T C 11: 117,822,107 E98G probably damaging Het
Trim13 G A 14: 61,605,700 V389I probably benign Het
Ttc28 A T 5: 111,235,500 Y1289F probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ugt1a10 T A 1: 88,056,182 V234D probably benign Het
Vmn2r75 C T 7: 86,165,367 G306E probably benign Het
Vmn2r86 C T 10: 130,453,628 V133I probably benign Het
Vps13c C A 9: 67,934,476 Q1927K probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp219 T A 14: 52,006,938 T550S probably benign Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Other mutations in Kcnab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01819:Kcnab1 APN 3 65319454 missense probably damaging 1.00
IGL01936:Kcnab1 APN 3 65358274 missense probably damaging 1.00
IGL02291:Kcnab1 APN 3 65357082 missense possibly damaging 0.94
IGL02425:Kcnab1 APN 3 65302179 missense possibly damaging 0.59
PIT4418001:Kcnab1 UTSW 3 65358320 missense probably benign 0.12
R0017:Kcnab1 UTSW 3 65357106 missense probably damaging 0.98
R0017:Kcnab1 UTSW 3 65357106 missense probably damaging 0.98
R0812:Kcnab1 UTSW 3 65297720 missense probably damaging 1.00
R1847:Kcnab1 UTSW 3 65302194 critical splice donor site probably null
R1926:Kcnab1 UTSW 3 65376512 missense possibly damaging 0.73
R2064:Kcnab1 UTSW 3 65364639 missense probably benign 0.07
R2152:Kcnab1 UTSW 3 65371440 missense probably damaging 0.99
R2153:Kcnab1 UTSW 3 65371440 missense probably damaging 0.99
R2197:Kcnab1 UTSW 3 65109947 missense probably benign 0.00
R2233:Kcnab1 UTSW 3 65319467 missense probably damaging 1.00
R2235:Kcnab1 UTSW 3 65319467 missense probably damaging 1.00
R2437:Kcnab1 UTSW 3 65357014 splice site probably benign
R3916:Kcnab1 UTSW 3 65304164 critical splice donor site probably null
R4093:Kcnab1 UTSW 3 65299614 missense possibly damaging 0.96
R4347:Kcnab1 UTSW 3 65297475 intron probably benign
R4796:Kcnab1 UTSW 3 65304165 critical splice donor site probably null
R5588:Kcnab1 UTSW 3 65376555 missense possibly damaging 0.59
R7254:Kcnab1 UTSW 3 65319487 missense probably benign 0.08
R7347:Kcnab1 UTSW 3 65376531 missense probably benign 0.07
R7424:Kcnab1 UTSW 3 65266503 missense possibly damaging 0.80
Z1177:Kcnab1 UTSW 3 65266510 missense probably damaging 0.99
Z1177:Kcnab1 UTSW 3 65357133 missense probably benign 0.08
Predicted Primers
Posted On2015-02-04