Incidental Mutation 'R0811:Fras1'
ID262337
Institutional Source Beutler Lab
Gene Symbol Fras1
Ensembl Gene ENSMUSG00000034687
Gene NameFraser extracellular matrix complex subunit 1
Synonymsbl, E130113P14Rik
MMRRC Submission 038991-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0811 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location96373955-96784728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96752998 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 3025 (S3025R)
Ref Sequence ENSEMBL: ENSMUSP00000043250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036019]
Predicted Effect probably benign
Transcript: ENSMUST00000036019
AA Change: S3025R

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043250
Gene: ENSMUSG00000034687
AA Change: S3025R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 27 86 9.23e-9 SMART
VWC 94 151 9.37e-10 SMART
VWC 158 215 8.61e-9 SMART
VWC 220 277 7.1e-10 SMART
VWC 284 341 7.8e-7 SMART
VWC 365 415 1.93e-1 SMART
FU 408 459 3.33e-1 SMART
FU 461 504 9.12e-8 SMART
EGF_like 466 495 6.67e1 SMART
FU 506 552 6.01e-8 SMART
FU 554 598 2.21e-6 SMART
FU 601 646 1.28e-11 SMART
FU 648 704 4.19e-7 SMART
FU 707 752 9.12e-8 SMART
FU 754 799 1.11e-6 SMART
EGF_like 759 790 7.23e1 SMART
FU 802 851 5.44e-6 SMART
EGF_like 807 842 4.55e1 SMART
FU 853 899 7.4e-8 SMART
FU 902 947 4.78e-2 SMART
FU 951 996 4.52e-12 SMART
EGF_like 956 987 2.75e1 SMART
FU 998 1041 1.38e-7 SMART
FU 1045 1088 9.7e-3 SMART
EGF_like 1057 1096 3.16e1 SMART
Pfam:Cadherin_3 1098 1198 5.2e-12 PFAM
Pfam:Cadherin_3 1167 1309 6.5e-27 PFAM
Pfam:Cadherin_3 1278 1442 7e-24 PFAM
Pfam:Cadherin_3 1411 1560 1.3e-23 PFAM
Pfam:Cadherin_3 1561 1693 6.4e-15 PFAM
Pfam:Cadherin_3 1695 1814 1.1e-10 PFAM
Pfam:Cadherin_3 1780 1940 1.6e-18 PFAM
Pfam:Cadherin_3 1906 2061 2.8e-22 PFAM
Pfam:Cadherin_3 2063 2181 3.3e-18 PFAM
Pfam:Cadherin_3 2172 2295 1.4e-26 PFAM
Pfam:Cadherin_3 2296 2408 2.3e-31 PFAM
Pfam:Cadherin_3 2413 2540 7.9e-23 PFAM
Calx_beta 2544 2648 1.23e-10 SMART
Calx_beta 2661 2772 3.3e-11 SMART
Calx_beta 2787 2892 1.21e-9 SMART
Calx_beta 2907 3009 4.45e-3 SMART
Calx_beta 3027 3131 1.5e-14 SMART
Blast:Calx_beta 3162 3187 1e-5 BLAST
transmembrane domain 3902 3924 N/A INTRINSIC
low complexity region 3927 3935 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein that appears to function in the regulation of epidermal-basement membrane adhesion and organogenesis during development. Mutations in this gene cause Fraser syndrome, a multisystem malformation that can include craniofacial, urogenital and respiratory system abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Survival is variable on genetic backgrounds. Kidney development is severely affected and syndactyly is common. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,713,414 F858S probably damaging Het
Abcb1a T C 5: 8,713,229 S586P probably damaging Het
Ap5z1 G A 5: 142,475,791 R583H probably benign Het
Arhgap28 TCAGCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAGCAG 17: 67,901,299 probably benign Het
Arrb1 G T 7: 99,598,501 V346L probably benign Het
Atrnl1 T A 19: 57,673,141 F518I probably benign Het
Bank1 T A 3: 136,093,366 I405F probably damaging Het
Cacna1h A G 17: 25,388,628 L905P probably damaging Het
Cc2d1a A G 8: 84,133,836 Y826H probably benign Het
Cenpo A G 12: 4,216,643 V155A probably benign Het
Cnmd A G 14: 79,661,423 F63S probably damaging Het
Cnn3 G A 3: 121,454,951 G72D probably damaging Het
Cox10 A G 11: 64,071,713 S101P probably benign Het
Ctdsp1 T C 1: 74,394,647 V129A probably damaging Het
Cyp2d34 A T 15: 82,618,606 S140T probably benign Het
Dennd5a G A 7: 109,933,613 H317Y possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Enox1 T A 14: 77,582,436 D210E probably damaging Het
Fam171a1 A G 2: 3,197,427 N190S probably damaging Het
Fat2 T A 11: 55,253,633 K4138N possibly damaging Het
Fat4 A T 3: 38,957,474 D2241V probably damaging Het
Fbn1 C T 2: 125,403,170 V266I possibly damaging Het
Gba T C 3: 89,204,000 I24T probably benign Het
Gdpd5 A G 7: 99,438,333 D68G probably damaging Het
Grid1 G A 14: 34,822,619 S49N probably benign Het
Grtp1 T C 8: 13,179,639 T250A possibly damaging Het
Gucy1b1 T C 3: 82,037,988 N448D probably benign Het
Hmcn2 G A 2: 31,420,371 A3326T probably damaging Het
Ippk C A 13: 49,443,471 Q254K probably damaging Het
Itga2 A T 13: 114,870,614 L393I possibly damaging Het
Kcna10 A T 3: 107,195,259 E402V possibly damaging Het
Kcnab1 G A 3: 65,297,720 D119N probably damaging Het
Kcnip4 T A 5: 48,409,860 T122S probably benign Het
Kcnma1 G A 14: 23,300,018 P1151L probably damaging Het
Klhl22 T A 16: 17,792,589 M568K probably benign Het
Krt6a C T 15: 101,692,748 V257M probably damaging Het
Ksr2 A C 5: 117,555,225 H246P probably damaging Het
Lca5 T C 9: 83,399,753 D326G possibly damaging Het
Lcp1 A G 14: 75,214,488 E393G probably benign Het
Leo1 G A 9: 75,445,549 E125K probably benign Het
Lipt1 T A 1: 37,875,301 V146E probably damaging Het
Mael A T 1: 166,235,399 probably null Het
Mga C T 2: 119,947,961 L1996F probably damaging Het
Mllt6 A G 11: 97,678,561 N913S probably damaging Het
Mphosph9 A C 5: 124,298,759 D507E probably damaging Het
Mvp G A 7: 126,987,556 A801V probably benign Het
Neb T C 2: 52,292,695 D1053G possibly damaging Het
Nubp1 C A 16: 10,413,721 L79I probably benign Het
Olfr397 G A 11: 73,965,420 E271K probably benign Het
Olfr924 G A 9: 38,848,509 V132I probably benign Het
Olfr97 A C 17: 37,232,332 L13V probably benign Het
Pithd1 A G 4: 135,977,134 probably benign Het
Pnpla8 G A 12: 44,283,405 V29M probably benign Het
Psmb2 T A 4: 126,707,557 I151N possibly damaging Het
Ptgs2 C T 1: 150,101,354 T104I probably benign Het
Ptpro A G 6: 137,368,079 T28A probably benign Het
Raf1 A G 6: 115,626,710 probably null Het
Ranbp2 T C 10: 58,465,529 M668T probably benign Het
Rbm48 A T 5: 3,591,760 probably null Het
Rhag A T 17: 40,831,578 T225S possibly damaging Het
Rhof A C 5: 123,131,887 L69R probably damaging Het
Slc22a1 T C 17: 12,666,618 probably benign Het
Slc24a5 T C 2: 125,068,804 S52P probably damaging Het
Slc8a2 T C 7: 16,141,114 V429A probably damaging Het
Spam1 G A 6: 24,796,887 R279H probably damaging Het
Spata16 T A 3: 26,913,338 probably benign Het
Srfbp1 A G 18: 52,487,516 D102G probably damaging Het
Srrm3 A C 5: 135,873,282 probably benign Het
Tbl1xr1 T A 3: 22,200,587 probably benign Het
Tk1 T C 11: 117,822,107 E98G probably damaging Het
Trim13 G A 14: 61,605,700 V389I probably benign Het
Ttc28 A T 5: 111,235,500 Y1289F probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ugt1a10 T A 1: 88,056,182 V234D probably benign Het
Vmn2r75 C T 7: 86,165,367 G306E probably benign Het
Vmn2r86 C T 10: 130,453,628 V133I probably benign Het
Vps13c C A 9: 67,934,476 Q1927K probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp219 T A 14: 52,006,938 T550S probably benign Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Other mutations in Fras1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Fras1 APN 5 96739358 missense possibly damaging 0.55
IGL00507:Fras1 APN 5 96778189 missense probably damaging 1.00
IGL00672:Fras1 APN 5 96759450 splice site probably benign
IGL00772:Fras1 APN 5 96636112 missense probably benign 0.42
IGL00844:Fras1 APN 5 96534853 splice site probably benign
IGL00913:Fras1 APN 5 96695076 missense probably damaging 0.99
IGL00959:Fras1 APN 5 96781281 missense probably damaging 0.96
IGL00966:Fras1 APN 5 96555221 missense probably benign 0.00
IGL01296:Fras1 APN 5 96673698 missense probably null 0.58
IGL01307:Fras1 APN 5 96781692 missense probably benign
IGL01481:Fras1 APN 5 96657241 missense probably damaging 1.00
IGL01525:Fras1 APN 5 96739336 missense probably damaging 0.99
IGL01599:Fras1 APN 5 96709891 missense possibly damaging 0.94
IGL01646:Fras1 APN 5 96758148 missense probably benign 0.29
IGL01795:Fras1 APN 5 96778045 missense probably damaging 1.00
IGL01867:Fras1 APN 5 96588131 missense probably benign
IGL01869:Fras1 APN 5 96708783 splice site probably benign
IGL01923:Fras1 APN 5 96735280 missense probably damaging 1.00
IGL01982:Fras1 APN 5 96739248 missense possibly damaging 0.46
IGL02109:Fras1 APN 5 96700523 missense probably benign
IGL02132:Fras1 APN 5 96781637 nonsense probably null
IGL02171:Fras1 APN 5 96735181 missense probably benign 0.15
IGL02213:Fras1 APN 5 96645871 nonsense probably null
IGL02277:Fras1 APN 5 96588118 missense probably benign 0.00
IGL02507:Fras1 APN 5 96657408 missense possibly damaging 0.95
IGL02589:Fras1 APN 5 96769513 missense probably damaging 1.00
IGL02671:Fras1 APN 5 96728616 missense possibly damaging 0.91
IGL02677:Fras1 APN 5 96545024 missense probably damaging 1.00
IGL02691:Fras1 APN 5 96744705 missense possibly damaging 0.68
IGL02741:Fras1 APN 5 96691371 missense probably benign 0.35
IGL02836:Fras1 APN 5 96534866 missense possibly damaging 0.67
IGL02850:Fras1 APN 5 96778175 missense probably damaging 1.00
IGL02998:Fras1 APN 5 96702181 missense possibly damaging 0.82
IGL03040:Fras1 APN 5 96710101 missense probably benign
IGL03078:Fras1 APN 5 96636135 missense probably damaging 1.00
IGL03096:Fras1 APN 5 96764901 missense probably damaging 1.00
IGL03102:Fras1 APN 5 96726535 missense probably benign 0.11
IGL03183:Fras1 APN 5 96733781 splice site probably benign
IGL03189:Fras1 APN 5 96743071 missense probably benign 0.00
IGL03193:Fras1 APN 5 96778106 missense probably damaging 0.99
IGL03292:Fras1 APN 5 96707491 missense probably damaging 1.00
IGL03328:Fras1 APN 5 96781760 missense probably damaging 0.96
IGL03335:Fras1 APN 5 96733944 splice site probably benign
IGL03394:Fras1 APN 5 96667477 missense probably damaging 0.98
IGL03404:Fras1 APN 5 96728581 missense probably damaging 0.99
baby_ruth UTSW 5 96708758 missense probably benign 0.01
I0000:Fras1 UTSW 5 96740829 missense probably damaging 0.99
PIT4581001:Fras1 UTSW 5 96555301 missense probably benign 0.01
R0028:Fras1 UTSW 5 96677316 missense probably benign 0.07
R0049:Fras1 UTSW 5 96776622 missense probably benign 0.07
R0049:Fras1 UTSW 5 96776622 missense probably benign 0.07
R0099:Fras1 UTSW 5 96614917 critical splice donor site probably null
R0109:Fras1 UTSW 5 96710077 missense probably benign 0.01
R0158:Fras1 UTSW 5 96776634 missense possibly damaging 0.83
R0268:Fras1 UTSW 5 96737009 missense probably damaging 0.99
R0305:Fras1 UTSW 5 96596888 missense probably benign
R0352:Fras1 UTSW 5 96726540 missense probably damaging 0.97
R0359:Fras1 UTSW 5 96762590 missense probably damaging 0.98
R0371:Fras1 UTSW 5 96555331 missense possibly damaging 0.90
R0379:Fras1 UTSW 5 96755509 nonsense probably null
R0395:Fras1 UTSW 5 96769653 missense possibly damaging 0.50
R0417:Fras1 UTSW 5 96691372 missense probably benign 0.18
R0454:Fras1 UTSW 5 96762665 missense probably damaging 0.96
R0456:Fras1 UTSW 5 96554788 missense probably damaging 1.00
R0456:Fras1 UTSW 5 96714343 splice site probably null
R0464:Fras1 UTSW 5 96636803 missense probably damaging 0.98
R0613:Fras1 UTSW 5 96700488 splice site probably benign
R0652:Fras1 UTSW 5 96781340 missense possibly damaging 0.91
R0675:Fras1 UTSW 5 96667387 splice site probably benign
R0765:Fras1 UTSW 5 96552796 missense probably benign 0.00
R0783:Fras1 UTSW 5 96768430 missense probably damaging 1.00
R0812:Fras1 UTSW 5 96752998 missense probably benign 0.35
R0943:Fras1 UTSW 5 96726543 missense probably benign 0.00
R1037:Fras1 UTSW 5 96714463 missense probably damaging 0.97
R1104:Fras1 UTSW 5 96708671 missense probably benign 0.00
R1108:Fras1 UTSW 5 96642629 missense probably damaging 0.99
R1332:Fras1 UTSW 5 96707308 missense probably benign 0.00
R1336:Fras1 UTSW 5 96707308 missense probably benign 0.00
R1458:Fras1 UTSW 5 96600733 missense probably benign 0.00
R1495:Fras1 UTSW 5 96528586 missense possibly damaging 0.49
R1499:Fras1 UTSW 5 96743187 missense probably benign 0.31
R1528:Fras1 UTSW 5 96636819 missense probably damaging 0.99
R1532:Fras1 UTSW 5 96713996 missense probably damaging 1.00
R1556:Fras1 UTSW 5 96743062 missense possibly damaging 0.88
R1625:Fras1 UTSW 5 96709978 missense possibly damaging 0.94
R1625:Fras1 UTSW 5 96713990 missense probably damaging 1.00
R1645:Fras1 UTSW 5 96700586 missense possibly damaging 0.90
R1647:Fras1 UTSW 5 96726613 critical splice donor site probably null
R1648:Fras1 UTSW 5 96726613 critical splice donor site probably null
R1661:Fras1 UTSW 5 96598909 missense probably damaging 1.00
R1665:Fras1 UTSW 5 96598909 missense probably damaging 1.00
R1682:Fras1 UTSW 5 96645873 missense probably benign 0.00
R1701:Fras1 UTSW 5 96600784 missense probably benign 0.00
R1716:Fras1 UTSW 5 96552725 missense probably benign 0.10
R1718:Fras1 UTSW 5 96554889 splice site probably null
R1800:Fras1 UTSW 5 96709882 missense probably benign
R1806:Fras1 UTSW 5 96713970 splice site probably benign
R1806:Fras1 UTSW 5 96764976 missense possibly damaging 0.88
R1822:Fras1 UTSW 5 96770688 missense probably damaging 1.00
R1823:Fras1 UTSW 5 96770688 missense probably damaging 1.00
R1824:Fras1 UTSW 5 96770688 missense probably damaging 1.00
R1847:Fras1 UTSW 5 96749423 intron probably null
R1929:Fras1 UTSW 5 96667437 missense probably benign 0.24
R1951:Fras1 UTSW 5 96712383 missense probably benign 0.38
R2093:Fras1 UTSW 5 96781203 missense probably damaging 1.00
R2283:Fras1 UTSW 5 96654305 missense probably benign 0.10
R2884:Fras1 UTSW 5 96700268 missense probably benign 0.07
R2913:Fras1 UTSW 5 96733915 missense probably benign
R2914:Fras1 UTSW 5 96733915 missense probably benign
R3054:Fras1 UTSW 5 96764943 missense probably damaging 0.99
R3117:Fras1 UTSW 5 96771712 missense probably damaging 1.00
R3118:Fras1 UTSW 5 96771712 missense probably damaging 1.00
R3691:Fras1 UTSW 5 96781512 missense probably benign 0.02
R3714:Fras1 UTSW 5 96645970 critical splice donor site probably null
R3715:Fras1 UTSW 5 96645970 critical splice donor site probably null
R3801:Fras1 UTSW 5 96733932 missense probably benign 0.26
R3961:Fras1 UTSW 5 96677385 critical splice donor site probably null
R4065:Fras1 UTSW 5 96770683 missense possibly damaging 0.64
R4066:Fras1 UTSW 5 96770683 missense possibly damaging 0.64
R4076:Fras1 UTSW 5 96743158 missense probably damaging 1.00
R4124:Fras1 UTSW 5 96770653 missense probably benign 0.05
R4127:Fras1 UTSW 5 96770653 missense probably benign 0.05
R4153:Fras1 UTSW 5 96776735 missense probably benign 0.17
R4233:Fras1 UTSW 5 96714376 missense possibly damaging 0.91
R4273:Fras1 UTSW 5 96614904 missense probably benign 0.00
R4355:Fras1 UTSW 5 96700242 missense probably benign
R4401:Fras1 UTSW 5 96642620 missense probably damaging 0.97
R4402:Fras1 UTSW 5 96642620 missense probably damaging 0.97
R4403:Fras1 UTSW 5 96642620 missense probably damaging 0.97
R4505:Fras1 UTSW 5 96781348 missense probably damaging 1.00
R4548:Fras1 UTSW 5 96709895 missense probably benign 0.00
R4559:Fras1 UTSW 5 96781289 missense probably damaging 1.00
R4629:Fras1 UTSW 5 96776734 missense probably benign 0.00
R4637:Fras1 UTSW 5 96778088 missense probably damaging 1.00
R4678:Fras1 UTSW 5 96700568 missense probably benign 0.13
R4707:Fras1 UTSW 5 96735238 missense probably damaging 0.96
R4735:Fras1 UTSW 5 96588163 missense probably benign 0.00
R4756:Fras1 UTSW 5 96781659 missense probably benign 0.00
R4762:Fras1 UTSW 5 96731618 missense probably benign
R4820:Fras1 UTSW 5 96728653 missense probably benign 0.00
R4847:Fras1 UTSW 5 96544992 missense possibly damaging 0.94
R4857:Fras1 UTSW 5 96778159 missense probably benign 0.00
R4909:Fras1 UTSW 5 96708758 missense probably benign 0.01
R4931:Fras1 UTSW 5 96636840 missense probably benign 0.02
R4938:Fras1 UTSW 5 96776724 missense probably damaging 0.99
R4952:Fras1 UTSW 5 96647498 missense probably benign 0.01
R4965:Fras1 UTSW 5 96726580 missense possibly damaging 0.95
R4989:Fras1 UTSW 5 96650682 missense possibly damaging 0.75
R5151:Fras1 UTSW 5 96645110 missense probably damaging 1.00
R5168:Fras1 UTSW 5 96708757 missense probably benign 0.00
R5182:Fras1 UTSW 5 96636173 nonsense probably null
R5214:Fras1 UTSW 5 96769593 missense probably damaging 1.00
R5220:Fras1 UTSW 5 96768363 missense probably damaging 1.00
R5235:Fras1 UTSW 5 96600750 missense probably benign 0.02
R5242:Fras1 UTSW 5 96657250 missense probably benign 0.11
R5253:Fras1 UTSW 5 96741025 missense probably damaging 0.99
R5260:Fras1 UTSW 5 96735187 missense possibly damaging 0.79
R5301:Fras1 UTSW 5 96657266 missense possibly damaging 0.88
R5411:Fras1 UTSW 5 96645160 missense probably benign 0.00
R5467:Fras1 UTSW 5 96780053 missense probably benign 0.04
R5543:Fras1 UTSW 5 96528535 missense probably benign 0.01
R5555:Fras1 UTSW 5 96677377 missense probably benign 0.34
R5602:Fras1 UTSW 5 96737021 missense probably damaging 1.00
R5664:Fras1 UTSW 5 96728535 missense possibly damaging 0.91
R5695:Fras1 UTSW 5 96781344 missense probably damaging 1.00
R5717:Fras1 UTSW 5 96781737 missense possibly damaging 0.93
R5742:Fras1 UTSW 5 96768381 missense possibly damaging 0.50
R5759:Fras1 UTSW 5 96709916 missense probably benign 0.02
R5766:Fras1 UTSW 5 96731689 missense possibly damaging 0.91
R5890:Fras1 UTSW 5 96645948 missense probably benign
R6052:Fras1 UTSW 5 96764866 missense probably damaging 1.00
R6058:Fras1 UTSW 5 96709985 missense probably benign
R6256:Fras1 UTSW 5 96733843 missense possibly damaging 0.84
R6306:Fras1 UTSW 5 96764946 missense probably damaging 1.00
R6494:Fras1 UTSW 5 96759564 missense possibly damaging 0.59
R6638:Fras1 UTSW 5 96758094 missense possibly damaging 0.94
R6647:Fras1 UTSW 5 96735202 missense probably damaging 1.00
R6725:Fras1 UTSW 5 96781340 missense possibly damaging 0.91
R6769:Fras1 UTSW 5 96598941 missense possibly damaging 0.60
R6771:Fras1 UTSW 5 96598941 missense possibly damaging 0.60
R6837:Fras1 UTSW 5 96726973 missense probably damaging 0.99
R6841:Fras1 UTSW 5 96728551 missense probably damaging 0.99
R6863:Fras1 UTSW 5 96543306 missense probably benign 0.19
R6868:Fras1 UTSW 5 96682378 missense probably benign 0.38
R6936:Fras1 UTSW 5 96768352 missense possibly damaging 0.92
R6997:Fras1 UTSW 5 96614873 nonsense probably null
R7023:Fras1 UTSW 5 96710084 missense probably benign 0.00
R7091:Fras1 UTSW 5 96708676 missense probably benign
R7102:Fras1 UTSW 5 96571041 missense probably benign
R7120:Fras1 UTSW 5 96752960 nonsense probably null
R7124:Fras1 UTSW 5 96714401 missense probably damaging 1.00
R7129:Fras1 UTSW 5 96781284 missense probably benign 0.00
R7173:Fras1 UTSW 5 96778078 missense probably damaging 1.00
R7174:Fras1 UTSW 5 96755577 critical splice donor site probably null
R7185:Fras1 UTSW 5 96636776 missense probably damaging 1.00
R7191:Fras1 UTSW 5 96614912 missense probably benign 0.05
R7216:Fras1 UTSW 5 96739314 missense probably damaging 1.00
R7222:Fras1 UTSW 5 96636186 missense probably damaging 1.00
R7222:Fras1 UTSW 5 96636809 missense probably benign 0.00
R7320:Fras1 UTSW 5 96709886 missense probably benign 0.03
R7335:Fras1 UTSW 5 96736970 missense possibly damaging 0.82
R7378:Fras1 UTSW 5 96596785 missense probably damaging 0.98
R7394:Fras1 UTSW 5 96712450 nonsense probably null
R7412:Fras1 UTSW 5 96614889 missense probably benign 0.06
R7422:Fras1 UTSW 5 96673599 missense probably benign 0.21
R7552:Fras1 UTSW 5 96768438 missense probably damaging 1.00
R7559:Fras1 UTSW 5 96740854 missense possibly damaging 0.82
R7575:Fras1 UTSW 5 96543314 missense probably benign 0.02
R7578:Fras1 UTSW 5 96684437 missense probably damaging 1.00
R7600:Fras1 UTSW 5 96684436 missense probably damaging 1.00
R7669:Fras1 UTSW 5 96692624 missense probably benign 0.01
R7710:Fras1 UTSW 5 96645103 nonsense probably null
R7722:Fras1 UTSW 5 96769554 missense probably damaging 1.00
R7726:Fras1 UTSW 5 96712451 missense probably benign 0.41
R7745:Fras1 UTSW 5 96726895 missense probably benign 0.11
R7777:Fras1 UTSW 5 96752904 missense probably damaging 1.00
R8000:Fras1 UTSW 5 96762677 missense probably damaging 0.96
R8056:Fras1 UTSW 5 96744774 missense probably damaging 1.00
R8058:Fras1 UTSW 5 96694919 missense probably benign
R8117:Fras1 UTSW 5 96707386 missense probably damaging 1.00
R8157:Fras1 UTSW 5 96554855 missense probably benign 0.00
Z1088:Fras1 UTSW 5 96743211 missense probably damaging 0.97
Z1088:Fras1 UTSW 5 96758142 missense probably benign
Z1176:Fras1 UTSW 5 96758142 missense probably benign
Z1177:Fras1 UTSW 5 96691457 missense probably damaging 1.00
Z1177:Fras1 UTSW 5 96700251 missense possibly damaging 0.71
Z1177:Fras1 UTSW 5 96740811 missense probably benign 0.18
Z1177:Fras1 UTSW 5 96740983 missense possibly damaging 0.95
Z1177:Fras1 UTSW 5 96758142 missense probably benign
Predicted Primers
Posted On2015-02-04