Mutagenetix > Incidental Mutations

Incidental Mutation 'R0884:Pigz'

262374

Institutional Source

Beutler Lab

Gene Symbol

Pigz

Ensembl Gene

ENSMUSG00000045625

Gene Name

phosphatidylinositol glycan anchor biosynthesis, class Z

Synonyms

MMRRC Submission

039051-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0884 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31933851-31946046 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 31941976 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000156038 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052174] [ENSMUST00000134666] [ENSMUST00000134928] [ENSMUST00000151412]

Predicted Effect

probably null
Transcript: ENSMUST00000052174

SMART Domains

Protein: ENSMUSP00000057509
Gene: ENSMUSG00000045625

Domain	Start	End	E-Value	Type
Pfam:Glyco_transf_22	7	446	1.3e-59	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000134666

Predicted Effect

probably null
Transcript: ENSMUST00000134928

Predicted Effect

probably null
Transcript: ENSMUST00000151412

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. This gene encodes a protein that is localized to the endoplasmic reticulum, and is involved in GPI anchor biosynthesis. As shown for the yeast homolog, which is a member of a family of dolichol-phosphate-mannose (Dol-P-Man)-dependent mannosyltransferases, this protein can also add a side-branching fourth mannose to GPI precursors during the assembly of GPI anchors. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc4	A	T	14: 118,553,288	I844N	possibly damaging	Het
Acbd3	CGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGA	1: 180,747,059		probably benign	Het
Adam6b	A	T	12: 113,490,995	R477S	probably damaging	Het
Aqp7	T	A	4: 41,034,929	T175S	possibly damaging	Het
Bclaf1	A	T	10: 20,322,076	R22*	probably null	Het
Bend7	A	T	2: 4,744,244	K57N	probably damaging	Het
Bicc1	A	C	10: 70,958,847	V160G	probably damaging	Het
Cacna2d4	C	T	6: 119,307,286	R745W	probably damaging	Het
Cep72	A	G	13: 74,054,881		probably null	Het
Cobl	A	G	11: 12,375,908	I196T	possibly damaging	Het
Cux1	T	G	5: 136,307,835	D941A	probably damaging	Het
Cyp2a12	T	C	7: 27,032,542	I236T	probably benign	Het
Depdc5	T	A	5: 32,917,978	V500D	possibly damaging	Het
Dhx35	T	C	2: 158,831,711	I354T	probably damaging	Het
Dnase1l2	A	G	17: 24,441,880	V170A	possibly damaging	Het
Eif4g3	C	A	4: 138,151,776	N588K	possibly damaging	Het
Epsti1	A	T	14: 77,931,275	R117S	probably damaging	Het
Fam53a	T	C	5: 33,600,816	E321G	probably benign	Het
Fat4	C	A	3: 38,982,858	T3553K	possibly damaging	Het
Fer1l4	T	C	2: 156,019,313	T1978A	possibly damaging	Het
Gabarapl2	A	T	8: 111,942,505	I32F	probably damaging	Het
Gje1	G	T	10: 14,716,740	S99R	possibly damaging	Het
Gm13083	A	G	4: 143,615,184	D61G	probably benign	Het
Gosr1	A	G	11: 76,730,146	I239T	probably benign	Het
Gpnmb	T	C	6: 49,047,913	V293A	possibly damaging	Het
Hyi	T	A	4: 118,360,217	I62N	probably damaging	Het
Il4ra	A	G	7: 125,574,663	I267V	probably damaging	Het
Kcnd2	A	T	6: 21,216,541	Q81H	probably benign	Het
Ksr1	A	T	11: 79,021,503	H675Q	possibly damaging	Het
Lpcat4	A	G	2: 112,242,732	N208S	probably damaging	Het
Muc3	T	A	5: 137,142,298	T162S	possibly damaging	Het
Mup3	T	A	4: 62,087,174	I20F	possibly damaging	Het
Nebl	A	C	2: 17,411,118	S327A	probably benign	Het
Nfatc4	A	C	14: 55,826,644	D126A	probably damaging	Het
Nmt2	A	T	2: 3,314,785	R271*	probably null	Het
Nol7	G	A	13: 43,400,615	V133I	probably benign	Het
Olfr376	A	T	11: 73,374,889	I47F	probably benign	Het
Olfr610	C	T	7: 103,506,862	W28*	probably null	Het
Pde4d	A	T	13: 109,950,940	I670L	probably damaging	Het
Phlpp1	T	A	1: 106,389,665		probably null	Het
Prrg4	A	T	2: 104,839,362	Y137N	probably damaging	Het
Rbm28	A	T	6: 29,155,154	S217T	possibly damaging	Het
Ryr2	T	C	13: 11,554,529	D4963G	probably damaging	Het
Slc35b2	T	A	17: 45,566,825	F293I	probably damaging	Het
Slc35f1	A	T	10: 53,089,347	Y286F	probably damaging	Het
Slc6a18	G	T	13: 73,667,037	A384D	probably damaging	Het
St5	A	G	7: 109,557,345	L66P	probably damaging	Het
Syt9	A	G	7: 107,436,561	I262V	probably damaging	Het
Tln2	C	A	9: 67,370,733	R333L	probably damaging	Het
Tnrc6b	ACAGCAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAGCAG	15: 80,902,555		probably benign	Het
Ttn	G	A	2: 76,751,066	T14834I	possibly damaging	Het
Uggt1	T	C	1: 36,175,078	S177G	probably benign	Het
Zfp454	A	G	11: 50,873,937	S223P	probably benign	Het
Zmat4	A	G	8: 24,015,127	T128A	probably benign	Het

Other mutations in Pigz

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02697:Pigz	APN	16	31944759	splice site	probably null
IGL02963:Pigz	APN	16	31944535	missense	probably damaging	0.99
lust	UTSW	16	31944937	missense	probably damaging	1.00
R1252:Pigz	UTSW	16	31941990	missense	possibly damaging	0.49
R1776:Pigz	UTSW	16	31944579	missense	probably damaging	0.99
R4744:Pigz	UTSW	16	31945333	missense	probably damaging	1.00
R5480:Pigz	UTSW	16	31944621	missense	probably damaging	0.97
R5793:Pigz	UTSW	16	31945467	missense	probably benign	0.00
R5905:Pigz	UTSW	16	31945428	missense	probably benign	0.26
R6025:Pigz	UTSW	16	31945710	missense	probably damaging	1.00
R6251:Pigz	UTSW	16	31945606	missense	possibly damaging	0.94
R6297:Pigz	UTSW	16	31944937	missense	probably damaging	1.00
R6735:Pigz	UTSW	16	31945543	missense	probably benign	0.01
R6770:Pigz	UTSW	16	31945750	missense	probably damaging	1.00
R6855:Pigz	UTSW	16	31945218	missense	possibly damaging	0.85
R7541:Pigz	UTSW	16	31945131	missense	probably benign	0.00
R8080:Pigz	UTSW	16	31942040	missense	probably damaging	1.00
Z1177:Pigz	UTSW	16	31944525	missense	probably damaging	0.99

Predicted Primers

Posted On

2015-02-04