Incidental Mutation 'R0988:Rragc'
ID262399
Institutional Source Beutler Lab
Gene Symbol Rragc
Ensembl Gene ENSMUSG00000028646
Gene NameRas-related GTP binding C
SynonymsTIB929, Gtr2, YGR163W
MMRRC Submission 039108-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R0988 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location123917446-123936997 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 123924782 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030399] [ENSMUST00000155757]
Predicted Effect probably null
Transcript: ENSMUST00000030399
SMART Domains Protein: ENSMUSP00000030399
Gene: ENSMUSG00000028646

DomainStartEndE-ValueType
Pfam:Arf 55 234 5.1e-7 PFAM
Pfam:SRPRB 58 154 9.8e-7 PFAM
Pfam:Gtr1_RagA 62 288 2.1e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155454
Predicted Effect probably benign
Transcript: ENSMUST00000155757
SMART Domains Protein: ENSMUSP00000115232
Gene: ENSMUSG00000028646

DomainStartEndE-ValueType
Pfam:Arf 55 157 1.7e-6 PFAM
Pfam:SRPRB 58 156 6.3e-8 PFAM
Pfam:Gtr1_RagA 62 178 1.5e-30 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTR/RAG GTP-binding protein family. The encoded protein is a monomeric guanine nucleotide-binding protein which forms a heterodimer with RRAGA and RRAGB and is primarily localized to the cytoplasm. The encoded protein promotes intracellular localization of the mTOR complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,932,575 I340V probably benign Het
Ano1 T G 7: 144,633,653 S459R possibly damaging Het
Cop1 T C 1: 159,232,847 V67A possibly damaging Het
Cop1 A G 1: 159,244,672 Y186C probably damaging Het
Cst11 G A 2: 148,770,426 T97I probably benign Het
Ephb2 T A 4: 136,659,708 Y736F possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
H2afy T C 13: 56,083,296 probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hpn T C 7: 31,099,898 Y271C possibly damaging Het
Kmt2a A G 9: 44,848,549 S668P probably benign Het
Krtap4-9 T A 11: 99,785,536 C94* probably null Het
Lgmn T C 12: 102,398,277 D311G probably damaging Het
Mfsd14b T C 13: 65,112,493 probably benign Het
Micu1 C A 10: 59,756,727 probably benign Het
Muc5b A G 7: 141,871,795 I4726V probably benign Het
Nadk2 T A 15: 9,102,992 N310K probably damaging Het
Napg T C 18: 62,983,360 probably benign Het
Nav3 G A 10: 109,716,528 R1818W probably damaging Het
Ntpcr T C 8: 125,737,431 probably benign Het
Olfr1451 A G 19: 12,999,787 D267G probably benign Het
Olfr341 T C 2: 36,479,767 D121G probably damaging Het
Olfr609 T A 7: 103,492,747 I44F probably damaging Het
Olfr807 A G 10: 129,754,997 V151A probably benign Het
Pdia2 A G 17: 26,198,829 F69L probably damaging Het
Pik3r4 A G 9: 105,687,205 T1333A probably damaging Het
Platr26 A T 2: 71,723,287 noncoding transcript Het
Proc T C 18: 32,133,483 D97G probably benign Het
Ptpn23 C T 9: 110,388,777 R700H probably benign Het
Serac1 A T 17: 6,061,580 F244I probably benign Het
Snrpd3 A G 10: 75,532,205 D52G probably damaging Het
Thrb G T 14: 17,981,837 probably benign Het
Ttc6 T C 12: 57,688,649 probably benign Het
Zfp607b T A 7: 27,702,976 C286S probably benign Het
Other mutations in Rragc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Rragc APN 4 123919843 unclassified probably benign
IGL01067:Rragc APN 4 123929968 missense probably benign 0.12
IGL01843:Rragc APN 4 123921059 missense probably damaging 1.00
IGL02302:Rragc APN 4 123921086 missense possibly damaging 0.65
IGL02368:Rragc APN 4 123921111 missense probably benign 0.11
R0740:Rragc UTSW 4 123924763 missense probably damaging 1.00
R4620:Rragc UTSW 4 123924829 missense probably damaging 0.98
R5169:Rragc UTSW 4 123935664 missense probably damaging 0.96
R5727:Rragc UTSW 4 123920035 missense possibly damaging 0.66
R5729:Rragc UTSW 4 123924852 missense possibly damaging 0.60
R5959:Rragc UTSW 4 123923974 missense probably damaging 1.00
R6197:Rragc UTSW 4 123917547 missense possibly damaging 0.90
R7860:Rragc UTSW 4 123929924 missense probably damaging 0.99
R8008:Rragc UTSW 4 123935547 missense probably damaging 0.96
Predicted Primers
Posted On2015-02-04