Incidental Mutation 'ANU05:Dusp19'
ID262470
Institutional Source Beutler Lab
Gene Symbol Dusp19
Ensembl Gene ENSMUSG00000027001
Gene Namedual specificity phosphatase 19
SynonymsSKRP1, TS-DSP1, 5930436K22Rik, C79103
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #ANU05
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location80617045-80632361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80624274 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 113 (T113A)
Ref Sequence ENSEMBL: ENSMUSP00000028384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028384]
Predicted Effect probably benign
Transcript: ENSMUST00000028384
AA Change: T113A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000028384
Gene: ENSMUSG00000027001
AA Change: T113A

DomainStartEndE-ValueType
DSPc 64 202 7.6e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196622
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dual-specificity phosphatases (DUSPs) constitute a large heterogeneous subgroup of the type I cysteine-based protein-tyrosine phosphatase superfamily. DUSPs are characterized by their ability to dephosphorylate both tyrosine and serine/threonine residues. They have been implicated as major modulators of critical signaling pathways. DUSP19 contains a variation of the consensus DUSP C-terminal catalytic domain, with the last serine residue replaced by alanine, and lacks the N-terminal CH2 domain found in the MKP (mitogen-activated protein kinase phosphatase) class of DUSPs (see MIM 600714) (summary by Patterson et al., 2009 [PubMed 19228121]).[supplied by OMIM, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110038F14Rik G A 15: 76,950,275 V124I probably damaging Het
1700019N19Rik A T 19: 58,789,113 H80Q probably damaging Het
Acaca A G 11: 84,315,852 K1513E probably damaging Het
Acacb T A 5: 114,225,870 F1464Y probably benign Het
Adgrg6 G A 10: 14,410,530 A1114V possibly damaging Het
Agl A G 3: 116,772,789 I975T possibly damaging Het
Akap7 T C 10: 25,271,553 H93R probably damaging Het
Arhgef11 T C 3: 87,733,174 W1213R probably benign Het
Ccar1 T A 10: 62,756,649 E708V probably damaging Het
Cfap206 C T 4: 34,721,562 S162N probably damaging Het
Cilp T C 9: 65,278,983 S787P possibly damaging Het
Col6a3 G A 1: 90,802,292 T1157I probably damaging Het
D630003M21Rik T C 2: 158,196,388 Y1046C probably benign Het
Dock3 A G 9: 106,895,663 S464P probably benign Het
Dync1h1 A C 12: 110,649,104 Y2957S probably benign Het
Epdr1 T C 13: 19,594,644 Y94C probably damaging Het
Fcho1 A T 8: 71,712,547 L422Q probably benign Het
Gca T A 2: 62,690,443 Y210* probably null Het
Gpnmb T C 6: 49,055,681 V513A probably benign Het
Irx4 A G 13: 73,267,667 T192A probably damaging Het
Isca1 T C 13: 59,758,971 T54A probably benign Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
L3mbtl1 T C 2: 162,970,180 V715A probably benign Het
Lama1 G A 17: 67,738,870 D257N probably damaging Het
Lgr5 T C 10: 115,478,534 H166R probably damaging Het
M6pr A G 6: 122,312,259 R9G probably benign Het
Nmt2 T G 2: 3,314,694 S240R probably benign Het
Npas3 A G 12: 54,068,074 E593G possibly damaging Het
Olfr1076 G A 2: 86,509,169 A237T possibly damaging Het
Pank4 T C 4: 154,974,646 M412T probably damaging Het
Psd A G 19: 46,314,747 V100A possibly damaging Het
Rab11fip3 T C 17: 26,016,113 T28A probably damaging Het
Rnpepl1 A T 1: 92,919,746 D685V probably benign Het
Rrad T C 8: 104,630,651 E88G probably benign Het
Sdk2 T A 11: 113,843,080 M846L probably benign Het
Sparcl1 A T 5: 104,094,715 V36E possibly damaging Het
Srrm4 C T 5: 116,467,569 E210K unknown Het
Stk25 A T 1: 93,623,423 probably null Het
Tacr3 A T 3: 134,930,049 Y338F probably damaging Het
Tap2 A T 17: 34,209,210 Q286L probably benign Het
Tedc1 C T 12: 113,163,188 R357* probably null Het
Tubgcp5 C A 7: 55,808,529 A396E possibly damaging Het
Ube2o T C 11: 116,540,134 D980G probably damaging Het
Vmn1r86 T C 7: 13,102,506 M98V probably benign Het
Vmn2r58 T A 7: 41,864,511 H236L probably benign Het
Zfp521 T C 18: 13,817,246 H1217R probably damaging Het
Zfyve1 A T 12: 83,555,005 F110I probably benign Het
Other mutations in Dusp19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Dusp19 APN 2 80630925 missense probably damaging 0.97
IGL00584:Dusp19 APN 2 80630782 splice site probably null
IGL01291:Dusp19 APN 2 80624274 missense probably benign 0.01
IGL01592:Dusp19 APN 2 80617481 missense probably damaging 1.00
IGL02808:Dusp19 APN 2 80617471 missense probably benign 0.04
IGL03002:Dusp19 APN 2 80630935 missense probably damaging 1.00
P0033:Dusp19 UTSW 2 80617385 start codon destroyed probably null 1.00
R4815:Dusp19 UTSW 2 80630945 missense probably benign 0.00
R5715:Dusp19 UTSW 2 80630986 missense probably benign 0.43
R7693:Dusp19 UTSW 2 80617561 missense probably benign 0.00
R8073:Dusp19 UTSW 2 80617484 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCCAGCATCAGTAAGCAGTTCTC -3'
(R):5'- TTGCAAAATGTACAAAGACTGGGCG -3'

Sequencing Primer
(F):5'- GCTTGTGATAGTAAGTTCACCC -3'
(R):5'- CGGTGGTCCTATGTTTTTGAATTTC -3'
Posted On2015-02-04