Incidental Mutation 'ANU05:Agl'
ID262475
Institutional Source Beutler Lab
Gene Symbol Agl
Ensembl Gene ENSMUSG00000033400
Gene Nameamylo-1,6-glucosidase, 4-alpha-glucanotransferase
Synonyms9430004C13Rik, 9630046L06Rik, 1110061O17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #ANU05
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location116739999-116808166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116772789 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 975 (I975T)
Ref Sequence ENSEMBL: ENSMUSP00000143582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040603] [ENSMUST00000159742] [ENSMUST00000161336] [ENSMUST00000162792]
Predicted Effect probably benign
Transcript: ENSMUST00000040603
AA Change: I975T

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000044012
Gene: ENSMUSG00000033400
AA Change: I975T

DomainStartEndE-ValueType
Pfam:hGDE_N 31 116 4.8e-24 PFAM
Pfam:hDGE_amylase 120 550 9.6e-167 PFAM
Pfam:hGDE_central 697 974 2e-90 PFAM
Pfam:GDE_C 1044 1527 8.5e-145 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159742
AA Change: I975T

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143582
Gene: ENSMUSG00000033400
AA Change: I975T

DomainStartEndE-ValueType
Pfam:hGDE_N 31 116 2.1e-20 PFAM
Pfam:hDGE_amylase 120 550 7.8e-164 PFAM
Pfam:hGDE_central 697 974 6.2e-87 PFAM
Pfam:GDE_C 1043 1279 6.7e-61 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000160484
AA Change: I310T
SMART Domains Protein: ENSMUSP00000123985
Gene: ENSMUSG00000033400
AA Change: I310T

DomainStartEndE-ValueType
Pfam:hGDE_central 33 310 2.8e-87 PFAM
Pfam:GDE_C 379 830 1.3e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161336
SMART Domains Protein: ENSMUSP00000123877
Gene: ENSMUSG00000033400

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 2.1e-29 PFAM
Pfam:hDGE_amylase 120 230 3.7e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162792
AA Change: I975T

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124149
Gene: ENSMUSG00000033400
AA Change: I975T

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 4e-28 PFAM
Pfam:hDGE_amylase 120 550 1.4e-167 PFAM
Pfam:hGDE_central 697 975 5.6e-95 PFAM
Pfam:GDE_C 1061 1527 1.1e-137 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the glycogen debrancher enzyme which is involved in glycogen degradation. This enzyme has two independent catalytic activities which occur at different sites on the protein: a 4-alpha-glucotransferase activity and a amylo-1,6-glucosidase activity. Mutations in this gene are associated with glycogen storage disease although a wide range of enzymatic and clinical variability occurs which may be due to tissue-specific alternative splicing. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to hypoglycemia, altered blood biochemistry, severe hepatomegaly, glycogen accumulation in the liver, heart, skeletal muscle and other tissues, motor impairment, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110038F14Rik G A 15: 76,950,275 V124I probably damaging Het
1700019N19Rik A T 19: 58,789,113 H80Q probably damaging Het
Acaca A G 11: 84,315,852 K1513E probably damaging Het
Acacb T A 5: 114,225,870 F1464Y probably benign Het
Adgrg6 G A 10: 14,410,530 A1114V possibly damaging Het
Akap7 T C 10: 25,271,553 H93R probably damaging Het
Arhgef11 T C 3: 87,733,174 W1213R probably benign Het
Ccar1 T A 10: 62,756,649 E708V probably damaging Het
Cfap206 C T 4: 34,721,562 S162N probably damaging Het
Cilp T C 9: 65,278,983 S787P possibly damaging Het
Col6a3 G A 1: 90,802,292 T1157I probably damaging Het
D630003M21Rik T C 2: 158,196,388 Y1046C probably benign Het
Dock3 A G 9: 106,895,663 S464P probably benign Het
Dusp19 A G 2: 80,624,274 T113A probably benign Het
Dync1h1 A C 12: 110,649,104 Y2957S probably benign Het
Epdr1 T C 13: 19,594,644 Y94C probably damaging Het
Fcho1 A T 8: 71,712,547 L422Q probably benign Het
Gca T A 2: 62,690,443 Y210* probably null Het
Gpnmb T C 6: 49,055,681 V513A probably benign Het
Irx4 A G 13: 73,267,667 T192A probably damaging Het
Isca1 T C 13: 59,758,971 T54A probably benign Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
L3mbtl1 T C 2: 162,970,180 V715A probably benign Het
Lama1 G A 17: 67,738,870 D257N probably damaging Het
Lgr5 T C 10: 115,478,534 H166R probably damaging Het
M6pr A G 6: 122,312,259 R9G probably benign Het
Nmt2 T G 2: 3,314,694 S240R probably benign Het
Npas3 A G 12: 54,068,074 E593G possibly damaging Het
Olfr1076 G A 2: 86,509,169 A237T possibly damaging Het
Pank4 T C 4: 154,974,646 M412T probably damaging Het
Psd A G 19: 46,314,747 V100A possibly damaging Het
Rab11fip3 T C 17: 26,016,113 T28A probably damaging Het
Rnpepl1 A T 1: 92,919,746 D685V probably benign Het
Rrad T C 8: 104,630,651 E88G probably benign Het
Sdk2 T A 11: 113,843,080 M846L probably benign Het
Sparcl1 A T 5: 104,094,715 V36E possibly damaging Het
Srrm4 C T 5: 116,467,569 E210K unknown Het
Stk25 A T 1: 93,623,423 probably null Het
Tacr3 A T 3: 134,930,049 Y338F probably damaging Het
Tap2 A T 17: 34,209,210 Q286L probably benign Het
Tedc1 C T 12: 113,163,188 R357* probably null Het
Tubgcp5 C A 7: 55,808,529 A396E possibly damaging Het
Ube2o T C 11: 116,540,134 D980G probably damaging Het
Vmn1r86 T C 7: 13,102,506 M98V probably benign Het
Vmn2r58 T A 7: 41,864,511 H236L probably benign Het
Zfp521 T C 18: 13,817,246 H1217R probably damaging Het
Zfyve1 A T 12: 83,555,005 F110I probably benign Het
Other mutations in Agl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Agl APN 3 116771483 missense probably benign 0.10
IGL00500:Agl APN 3 116772820 missense probably damaging 1.00
IGL00691:Agl APN 3 116779258 missense possibly damaging 0.46
IGL00711:Agl APN 3 116793627 missense probably damaging 1.00
IGL01291:Agl APN 3 116772789 missense possibly damaging 0.49
IGL01641:Agl APN 3 116784455 nonsense probably null
IGL01860:Agl APN 3 116772526 splice site probably benign
IGL01893:Agl APN 3 116788549 missense probably damaging 0.97
IGL02193:Agl APN 3 116779166 missense probably damaging 0.99
IGL02379:Agl APN 3 116779091 missense probably damaging 1.00
IGL02485:Agl APN 3 116779080 missense probably benign
IGL02644:Agl APN 3 116786597 missense probably damaging 1.00
IGL02673:Agl APN 3 116781599 missense probably benign 0.01
IGL02693:Agl APN 3 116746428 missense possibly damaging 0.67
IGL02733:Agl APN 3 116780997 missense probably benign
IGL03089:Agl APN 3 116781023 missense probably damaging 1.00
IGL03271:Agl APN 3 116779127 missense probably benign 0.00
PIT4445001:Agl UTSW 3 116771460 missense
R0013:Agl UTSW 3 116776608 nonsense probably null
R0013:Agl UTSW 3 116776608 nonsense probably null
R0022:Agl UTSW 3 116793836 splice site probably null
R0092:Agl UTSW 3 116793804 missense probably damaging 1.00
R0226:Agl UTSW 3 116752071 missense probably damaging 1.00
R0440:Agl UTSW 3 116758806 missense probably damaging 1.00
R0488:Agl UTSW 3 116754962 nonsense probably null
R0504:Agl UTSW 3 116786784 missense probably damaging 0.99
R0689:Agl UTSW 3 116793628 missense probably damaging 1.00
R0715:Agl UTSW 3 116752176 missense probably damaging 1.00
R0893:Agl UTSW 3 116753286 missense probably benign 0.04
R1403:Agl UTSW 3 116782597 missense probably benign 0.12
R1403:Agl UTSW 3 116782597 missense probably benign 0.12
R1432:Agl UTSW 3 116746693 missense probably damaging 1.00
R1465:Agl UTSW 3 116771372 missense probably benign 0.35
R1465:Agl UTSW 3 116771372 missense probably benign 0.35
R1540:Agl UTSW 3 116780735 missense probably benign 0.01
R1624:Agl UTSW 3 116787246 missense probably benign 0.30
R1640:Agl UTSW 3 116752090 missense probably benign 0.02
R1834:Agl UTSW 3 116788351 missense probably benign 0.31
R1853:Agl UTSW 3 116779322 nonsense probably null
R2004:Agl UTSW 3 116781265 missense probably damaging 1.00
R2184:Agl UTSW 3 116780777 missense probably benign 0.00
R2227:Agl UTSW 3 116788312 missense possibly damaging 0.78
R3053:Agl UTSW 3 116791033 missense probably damaging 1.00
R4181:Agl UTSW 3 116746630 missense probably damaging 1.00
R4241:Agl UTSW 3 116754848 intron probably benign
R4284:Agl UTSW 3 116752178 missense possibly damaging 0.83
R4285:Agl UTSW 3 116752178 missense possibly damaging 0.83
R4302:Agl UTSW 3 116746630 missense probably damaging 1.00
R4791:Agl UTSW 3 116786528 critical splice donor site probably null
R4854:Agl UTSW 3 116778618 critical splice donor site probably null
R4968:Agl UTSW 3 116788526 missense probably benign 0.31
R5075:Agl UTSW 3 116793807 missense probably damaging 1.00
R5219:Agl UTSW 3 116778721 missense possibly damaging 0.81
R5274:Agl UTSW 3 116772486 missense probably damaging 1.00
R5347:Agl UTSW 3 116791165 missense probably damaging 1.00
R5399:Agl UTSW 3 116781628 missense probably damaging 1.00
R5511:Agl UTSW 3 116788560 missense possibly damaging 0.81
R5763:Agl UTSW 3 116753360 missense probably damaging 1.00
R5827:Agl UTSW 3 116781054 missense probably damaging 1.00
R5964:Agl UTSW 3 116793774 missense probably damaging 1.00
R5967:Agl UTSW 3 116793708 missense probably benign 0.06
R5986:Agl UTSW 3 116772496 missense probably damaging 1.00
R6127:Agl UTSW 3 116758329 missense probably damaging 1.00
R6209:Agl UTSW 3 116785196 nonsense probably null
R6252:Agl UTSW 3 116787229 critical splice donor site probably null
R6337:Agl UTSW 3 116786777 missense possibly damaging 0.65
R6366:Agl UTSW 3 116791117 missense probably damaging 1.00
R6441:Agl UTSW 3 116771459 missense probably benign 0.21
R6647:Agl UTSW 3 116750411 missense probably damaging 1.00
R6678:Agl UTSW 3 116753320 missense probably damaging 0.99
R6736:Agl UTSW 3 116781680 missense probably damaging 0.98
R7141:Agl UTSW 3 116753286 missense probably benign 0.04
R7143:Agl UTSW 3 116792021 missense probably damaging 0.99
R7204:Agl UTSW 3 116793820 missense probably benign 0.04
R7259:Agl UTSW 3 116784581 missense probably damaging 1.00
R7393:Agl UTSW 3 116791156 missense probably benign
R7426:Agl UTSW 3 116758755 missense
R7559:Agl UTSW 3 116752115 missense
R7587:Agl UTSW 3 116792087 missense probably damaging 1.00
R7609:Agl UTSW 3 116807279 missense possibly damaging 0.93
R7657:Agl UTSW 3 116779163 missense
R7715:Agl UTSW 3 116758256 missense
R7735:Agl UTSW 3 116785146 missense probably benign 0.21
R7770:Agl UTSW 3 116758237 critical splice donor site probably null
X0065:Agl UTSW 3 116781330 nonsense probably null
Z1177:Agl UTSW 3 116781036 missense
Predicted Primers PCR Primer
(F):5'- TGTTTCCACGCTACATCCAGCAG -3'
(R):5'- AGCAGCAAGGACATTTGACTCAACC -3'

Sequencing Primer
(F):5'- CTACATCCAGCAGAGTGGTGTATG -3'
(R):5'- ACCAACAGCTCAGTAATGTCTC -3'
Posted On2015-02-04