Incidental Mutation 'ANU05:Sparcl1'
ID262481
Institutional Source Beutler Lab
Gene Symbol Sparcl1
Ensembl Gene ENSMUSG00000029309
Gene NameSPARC-like 1
SynonymsEcm2, mast9, Sc1, hevin
Accession Numbers

Ncbi RefSeq: NM_010097.4; MGI:108110

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #ANU05
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location104079111-104113733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104094715 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 36 (V36E)
Ref Sequence ENSEMBL: ENSMUSP00000031249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031249] [ENSMUST00000199947]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031249
AA Change: V36E

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031249
Gene: ENSMUSG00000029309
AA Change: V36E

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 90 101 N/A INTRINSIC
low complexity region 192 210 N/A INTRINSIC
low complexity region 330 340 N/A INTRINSIC
low complexity region 372 381 N/A INTRINSIC
FOLN 418 441 2.33e-5 SMART
KAZAL 441 495 3.62e-11 SMART
Pfam:SPARC_Ca_bdg 498 636 2.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199947
AA Change: V36E

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143177
Gene: ENSMUSG00000029309
AA Change: V36E

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 90 101 N/A INTRINSIC
low complexity region 192 210 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype Strain: 2153047
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal histology and survival. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(1) Gene trapped(4)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110038F14Rik G A 15: 76,950,275 V124I probably damaging Het
1700019N19Rik A T 19: 58,789,113 H80Q probably damaging Het
Acaca A G 11: 84,315,852 K1513E probably damaging Het
Acacb T A 5: 114,225,870 F1464Y probably benign Het
Adgrg6 G A 10: 14,410,530 A1114V possibly damaging Het
Agl A G 3: 116,772,789 I975T possibly damaging Het
Akap7 T C 10: 25,271,553 H93R probably damaging Het
Arhgef11 T C 3: 87,733,174 W1213R probably benign Het
Ccar1 T A 10: 62,756,649 E708V probably damaging Het
Cfap206 C T 4: 34,721,562 S162N probably damaging Het
Cilp T C 9: 65,278,983 S787P possibly damaging Het
Col6a3 G A 1: 90,802,292 T1157I probably damaging Het
D630003M21Rik T C 2: 158,196,388 Y1046C probably benign Het
Dock3 A G 9: 106,895,663 S464P probably benign Het
Dusp19 A G 2: 80,624,274 T113A probably benign Het
Dync1h1 A C 12: 110,649,104 Y2957S probably benign Het
Epdr1 T C 13: 19,594,644 Y94C probably damaging Het
Fcho1 A T 8: 71,712,547 L422Q probably benign Het
Gca T A 2: 62,690,443 Y210* probably null Het
Gpnmb T C 6: 49,055,681 V513A probably benign Het
Irx4 A G 13: 73,267,667 T192A probably damaging Het
Isca1 T C 13: 59,758,971 T54A probably benign Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
L3mbtl1 T C 2: 162,970,180 V715A probably benign Het
Lama1 G A 17: 67,738,870 D257N probably damaging Het
Lgr5 T C 10: 115,478,534 H166R probably damaging Het
M6pr A G 6: 122,312,259 R9G probably benign Het
Nmt2 T G 2: 3,314,694 S240R probably benign Het
Npas3 A G 12: 54,068,074 E593G possibly damaging Het
Olfr1076 G A 2: 86,509,169 A237T possibly damaging Het
Pank4 T C 4: 154,974,646 M412T probably damaging Het
Psd A G 19: 46,314,747 V100A possibly damaging Het
Rab11fip3 T C 17: 26,016,113 T28A probably damaging Het
Rnpepl1 A T 1: 92,919,746 D685V probably benign Het
Rrad T C 8: 104,630,651 E88G probably benign Het
Sdk2 T A 11: 113,843,080 M846L probably benign Het
Srrm4 C T 5: 116,467,569 E210K unknown Het
Stk25 A T 1: 93,623,423 probably null Het
Tacr3 A T 3: 134,930,049 Y338F probably damaging Het
Tap2 A T 17: 34,209,210 Q286L probably benign Het
Tedc1 C T 12: 113,163,188 R357* probably null Het
Tubgcp5 C A 7: 55,808,529 A396E possibly damaging Het
Ube2o T C 11: 116,540,134 D980G probably damaging Het
Vmn1r86 T C 7: 13,102,506 M98V probably benign Het
Vmn2r58 T A 7: 41,864,511 H236L probably benign Het
Zfp521 T C 18: 13,817,246 H1217R probably damaging Het
Zfyve1 A T 12: 83,555,005 F110I probably benign Het
Other mutations in Sparcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:Sparcl1 APN 5 104092922 missense probably benign 0.04
IGL01291:Sparcl1 APN 5 104094715 missense possibly damaging 0.88
IGL01958:Sparcl1 APN 5 104092540 missense probably benign 0.30
IGL02749:Sparcl1 APN 5 104092880 missense possibly damaging 0.57
IGL03034:Sparcl1 APN 5 104093237 missense probably damaging 0.96
R0007:Sparcl1 UTSW 5 104087080 missense probably damaging 1.00
R0007:Sparcl1 UTSW 5 104087080 missense probably damaging 1.00
R0071:Sparcl1 UTSW 5 104085841 nonsense probably null
R0071:Sparcl1 UTSW 5 104085841 nonsense probably null
R0278:Sparcl1 UTSW 5 104088397 missense probably benign 0.16
R0360:Sparcl1 UTSW 5 104089637 missense probably damaging 0.99
R0581:Sparcl1 UTSW 5 104093312 missense probably damaging 0.99
R1755:Sparcl1 UTSW 5 104092824 missense probably benign 0.12
R1807:Sparcl1 UTSW 5 104085761 missense probably damaging 1.00
R1925:Sparcl1 UTSW 5 104093354 missense probably benign 0.09
R2110:Sparcl1 UTSW 5 104088423 missense probably damaging 1.00
R2112:Sparcl1 UTSW 5 104088423 missense probably damaging 1.00
R2331:Sparcl1 UTSW 5 104085794 missense probably damaging 1.00
R2567:Sparcl1 UTSW 5 104085088 missense probably damaging 1.00
R3029:Sparcl1 UTSW 5 104093226 missense possibly damaging 0.59
R3104:Sparcl1 UTSW 5 104093337 missense probably benign 0.00
R3106:Sparcl1 UTSW 5 104093337 missense probably benign 0.00
R3979:Sparcl1 UTSW 5 104092781 missense probably benign 0.00
R4772:Sparcl1 UTSW 5 104088490 missense probably benign 0.15
R4967:Sparcl1 UTSW 5 104092910 missense probably damaging 1.00
R5095:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R5103:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R5105:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R5140:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R5149:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R6245:Sparcl1 UTSW 5 104085147 missense probably damaging 1.00
R6387:Sparcl1 UTSW 5 104085060 missense probably damaging 1.00
R6544:Sparcl1 UTSW 5 104092444 nonsense probably null
R6930:Sparcl1 UTSW 5 104087074 missense probably damaging 1.00
R7246:Sparcl1 UTSW 5 104085157 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGATCTTAACCAAAAGGCCGAGAAGC -3'
(R):5'- GGGACTGGACAGTGCTATATCCCAAG -3'

Sequencing Primer
(F):5'- caaaaggccgagaagcaatTTATC -3'
(R):5'- AATGTTTTCAGCCAGTCTTtgtatg -3'
Posted On2015-02-04