Incidental Mutation 'ANU05:Tubgcp5'
ID262490
Institutional Source Beutler Lab
Gene Symbol Tubgcp5
Ensembl Gene ENSMUSG00000033790
Gene Nametubulin, gamma complex associated protein 5
SynonymsB130010C12Rik, GCP5
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #ANU05
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location55794154-55831677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 55808529 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 396 (A396E)
Ref Sequence ENSEMBL: ENSMUSP00000146111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032627] [ENSMUST00000205796] [ENSMUST00000206191]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032627
AA Change: A396E

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790
AA Change: A396E

DomainStartEndE-ValueType
low complexity region 109 124 N/A INTRINSIC
Pfam:Spc97_Spc98 273 942 1.2e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205779
Predicted Effect possibly damaging
Transcript: ENSMUST00000205796
AA Change: A396E

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000206191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206789
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110038F14Rik G A 15: 76,950,275 V124I probably damaging Het
1700019N19Rik A T 19: 58,789,113 H80Q probably damaging Het
Acaca A G 11: 84,315,852 K1513E probably damaging Het
Acacb T A 5: 114,225,870 F1464Y probably benign Het
Adgrg6 G A 10: 14,410,530 A1114V possibly damaging Het
Agl A G 3: 116,772,789 I975T possibly damaging Het
Akap7 T C 10: 25,271,553 H93R probably damaging Het
Arhgef11 T C 3: 87,733,174 W1213R probably benign Het
Ccar1 T A 10: 62,756,649 E708V probably damaging Het
Cfap206 C T 4: 34,721,562 S162N probably damaging Het
Cilp T C 9: 65,278,983 S787P possibly damaging Het
Col6a3 G A 1: 90,802,292 T1157I probably damaging Het
D630003M21Rik T C 2: 158,196,388 Y1046C probably benign Het
Dock3 A G 9: 106,895,663 S464P probably benign Het
Dusp19 A G 2: 80,624,274 T113A probably benign Het
Dync1h1 A C 12: 110,649,104 Y2957S probably benign Het
Epdr1 T C 13: 19,594,644 Y94C probably damaging Het
Fcho1 A T 8: 71,712,547 L422Q probably benign Het
Gca T A 2: 62,690,443 Y210* probably null Het
Gpnmb T C 6: 49,055,681 V513A probably benign Het
Irx4 A G 13: 73,267,667 T192A probably damaging Het
Isca1 T C 13: 59,758,971 T54A probably benign Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
L3mbtl1 T C 2: 162,970,180 V715A probably benign Het
Lama1 G A 17: 67,738,870 D257N probably damaging Het
Lgr5 T C 10: 115,478,534 H166R probably damaging Het
M6pr A G 6: 122,312,259 R9G probably benign Het
Nmt2 T G 2: 3,314,694 S240R probably benign Het
Npas3 A G 12: 54,068,074 E593G possibly damaging Het
Olfr1076 G A 2: 86,509,169 A237T possibly damaging Het
Pank4 T C 4: 154,974,646 M412T probably damaging Het
Psd A G 19: 46,314,747 V100A possibly damaging Het
Rab11fip3 T C 17: 26,016,113 T28A probably damaging Het
Rnpepl1 A T 1: 92,919,746 D685V probably benign Het
Rrad T C 8: 104,630,651 E88G probably benign Het
Sdk2 T A 11: 113,843,080 M846L probably benign Het
Sparcl1 A T 5: 104,094,715 V36E possibly damaging Het
Srrm4 C T 5: 116,467,569 E210K unknown Het
Stk25 A T 1: 93,623,423 probably null Het
Tacr3 A T 3: 134,930,049 Y338F probably damaging Het
Tap2 A T 17: 34,209,210 Q286L probably benign Het
Tedc1 C T 12: 113,163,188 R357* probably null Het
Ube2o T C 11: 116,540,134 D980G probably damaging Het
Vmn1r86 T C 7: 13,102,506 M98V probably benign Het
Vmn2r58 T A 7: 41,864,511 H236L probably benign Het
Zfp521 T C 18: 13,817,246 H1217R probably damaging Het
Zfyve1 A T 12: 83,555,005 F110I probably benign Het
Other mutations in Tubgcp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Tubgcp5 APN 7 55806595 missense possibly damaging 0.91
IGL01291:Tubgcp5 APN 7 55808529 missense possibly damaging 0.83
IGL01343:Tubgcp5 APN 7 55796031 splice site probably benign
IGL01597:Tubgcp5 APN 7 55806832 splice site probably benign
IGL01688:Tubgcp5 APN 7 55815018 missense possibly damaging 0.92
IGL01843:Tubgcp5 APN 7 55799473 missense probably benign 0.02
IGL01950:Tubgcp5 APN 7 55806088 missense possibly damaging 0.93
IGL01957:Tubgcp5 APN 7 55818757 missense probably damaging 1.00
IGL02902:Tubgcp5 APN 7 55806607 nonsense probably null
IGL03105:Tubgcp5 APN 7 55825581 missense probably damaging 1.00
R0078:Tubgcp5 UTSW 7 55818895 missense probably damaging 1.00
R0322:Tubgcp5 UTSW 7 55814978 missense probably damaging 0.98
R0362:Tubgcp5 UTSW 7 55800684 missense probably damaging 1.00
R0449:Tubgcp5 UTSW 7 55823567 missense probably benign
R0488:Tubgcp5 UTSW 7 55829338 missense probably damaging 0.96
R0853:Tubgcp5 UTSW 7 55814851 splice site probably benign
R0885:Tubgcp5 UTSW 7 55806055 nonsense probably null
R1483:Tubgcp5 UTSW 7 55825707 critical splice donor site probably null
R1746:Tubgcp5 UTSW 7 55808537 missense probably benign 0.05
R1766:Tubgcp5 UTSW 7 55815020 missense probably benign 0.15
R2148:Tubgcp5 UTSW 7 55799511 missense probably damaging 1.00
R2229:Tubgcp5 UTSW 7 55830881 missense probably damaging 1.00
R3766:Tubgcp5 UTSW 7 55830866 missense probably damaging 0.98
R4154:Tubgcp5 UTSW 7 55805329 missense probably benign 0.01
R4838:Tubgcp5 UTSW 7 55794185 unclassified probably benign
R4948:Tubgcp5 UTSW 7 55806123 missense probably benign 0.00
R5110:Tubgcp5 UTSW 7 55808637 missense probably damaging 0.96
R5347:Tubgcp5 UTSW 7 55823685 missense probably damaging 1.00
R5417:Tubgcp5 UTSW 7 55825661 missense possibly damaging 0.90
R5574:Tubgcp5 UTSW 7 55805329 missense probably benign 0.01
R5758:Tubgcp5 UTSW 7 55818895 missense probably damaging 1.00
R5957:Tubgcp5 UTSW 7 55814962 missense probably benign 0.03
R6014:Tubgcp5 UTSW 7 55823609 missense probably benign
R6141:Tubgcp5 UTSW 7 55806778 missense probably benign 0.30
R6289:Tubgcp5 UTSW 7 55795923 missense probably benign 0.05
R6511:Tubgcp5 UTSW 7 55817392 nonsense probably null
R6563:Tubgcp5 UTSW 7 55825661 missense possibly damaging 0.90
R6574:Tubgcp5 UTSW 7 55823583 missense probably benign
R6596:Tubgcp5 UTSW 7 55806634 missense probably benign 0.38
R7016:Tubgcp5 UTSW 7 55794229 missense possibly damaging 0.76
R7038:Tubgcp5 UTSW 7 55805366 missense probably damaging 0.99
R7075:Tubgcp5 UTSW 7 55829407 missense probably benign 0.04
R7083:Tubgcp5 UTSW 7 55800695 nonsense probably null
R7213:Tubgcp5 UTSW 7 55806112 missense probably damaging 0.97
R7284:Tubgcp5 UTSW 7 55823567 missense probably benign
R7600:Tubgcp5 UTSW 7 55808513 missense probably benign
R7813:Tubgcp5 UTSW 7 55800696 missense possibly damaging 0.49
R7920:Tubgcp5 UTSW 7 55816562 missense probably benign 0.00
R7948:Tubgcp5 UTSW 7 55794248 missense probably benign 0.01
R8438:Tubgcp5 UTSW 7 55804615 missense possibly damaging 0.67
R8499:Tubgcp5 UTSW 7 55804615 missense possibly damaging 0.67
Z1088:Tubgcp5 UTSW 7 55815101 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGTGTCAGTGCCATCTGAGAAC -3'
(R):5'- GGCTTCGCCAACATTGTCATATTCAAG -3'

Sequencing Primer
(F):5'- aggcatccatacaggcaaac -3'
(R):5'- GCCAACATTGTCATATTCAAGAATGG -3'
Posted On2015-02-04