Incidental Mutation 'ANU18:Lct'
ID262521
Institutional Source Beutler Lab
Gene Symbol Lct
Ensembl Gene ENSMUSG00000026354
Gene Namelactase
SynonymsLPH, LOC226413, Lphl
Accession Numbers

Genbank: NM_001081078; MGI:104576

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #ANU18
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location128284756-128328318 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 128308047 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 408 (R408*)
Ref Sequence ENSEMBL: ENSMUSP00000073190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073490]
Predicted Effect probably null
Transcript: ENSMUST00000073490
AA Change: R408*
SMART Domains Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: R408*

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 76 226 1.6e-19 PFAM
low complexity region 322 340 N/A INTRINSIC
Pfam:Glyco_hydro_1 380 849 4.8e-169 PFAM
low complexity region 865 875 N/A INTRINSIC
Pfam:Glyco_hydro_1 902 1368 3.7e-181 PFAM
Pfam:Glyco_hydro_1 1377 1844 6.9e-183 PFAM
transmembrane domain 1885 1907 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C T 17: 14,943,919 probably null Het
Acacb A T 5: 114,246,498 I2238L probably benign Het
Aldh1l2 T C 10: 83,522,846 Y95C probably damaging Het
Asxl2 A G 12: 3,501,425 T1056A probably damaging Het
B4galnt1 A G 10: 127,169,779 T250A possibly damaging Het
Cela3b A T 4: 137,423,843 probably null Het
Chst3 T C 10: 60,185,832 T398A probably damaging Het
Cngb3 A G 4: 19,425,625 T478A probably damaging Het
Cyp4a10 T C 4: 115,518,455 L45P probably damaging Het
D630003M21Rik A G 2: 158,217,648 S111P probably benign Het
Defb21 A G 2: 152,574,751 E49G possibly damaging Het
Dnajc1 T C 2: 18,308,834 T159A probably damaging Het
Dnmbp A G 19: 43,902,354 S325P probably benign Het
Fam91a1 T C 15: 58,442,871 F534L probably damaging Het
Fermt2 T C 14: 45,464,863 E488G probably damaging Het
Filip1 T C 9: 79,819,180 D719G possibly damaging Het
Gad1-ps A G 10: 99,445,151 noncoding transcript Het
Glra3 C A 8: 55,940,962 A36E probably benign Het
Hnrnpm C T 17: 33,669,168 probably null Het
Lrrk2 T A 15: 91,767,339 Y1733N probably damaging Het
Mindy1 T C 3: 95,288,390 L148P probably damaging Het
Mkrn2 C A 6: 115,611,789 Y164* probably null Het
Msra T C 14: 64,210,435 Y135C probably damaging Het
Ndst3 C T 3: 123,548,916 A749T probably damaging Het
Ngdn G T 14: 55,017,114 A41S probably benign Het
Nlrp12 A T 7: 3,240,092 S597T probably damaging Het
Olfr1451 A T 19: 12,999,417 I144F probably damaging Het
Pabpc6 A G 17: 9,667,970 S551P probably benign Het
Plekhg5 C T 4: 152,112,553 A752V probably benign Het
Prpf4b T C 13: 34,884,291 S368P probably benign Het
Pus7 A G 5: 23,746,424 probably null Het
Rab40b C G 11: 121,357,962 V156L probably benign Het
Slc9a9 T A 9: 95,055,459 S455T probably benign Het
Tmem26 A T 10: 68,778,606 N284Y probably damaging Het
Tmem87a T C 2: 120,380,769 I232V probably benign Het
Trpm2 A G 10: 77,923,984 L1106P probably damaging Het
Tshz1 A G 18: 84,014,661 Y541H probably damaging Het
Zfp213 G T 17: 23,561,417 A43D probably benign Het
Zfp365 A G 10: 67,909,354 V198A probably damaging Het
Zfp618 G A 4: 63,132,826 V615M probably damaging Het
Other mutations in Lct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Lct APN 1 128287556 missense probably benign 0.09
IGL00970:Lct APN 1 128304068 missense probably damaging 1.00
IGL01022:Lct APN 1 128300859 missense probably benign
IGL01878:Lct APN 1 128294266 missense probably damaging 1.00
IGL01892:Lct APN 1 128307605 missense probably damaging 1.00
IGL02307:Lct APN 1 128286590 missense possibly damaging 0.70
IGL02434:Lct APN 1 128303790 missense probably damaging 0.97
IGL02559:Lct APN 1 128294266 missense probably damaging 1.00
IGL02623:Lct APN 1 128308251 missense probably benign 0.01
IGL02818:Lct APN 1 128300168 missense probably damaging 1.00
IGL02949:Lct APN 1 128313132 missense probably benign 0.26
IGL02951:Lct APN 1 128300211 missense probably damaging 1.00
IGL03087:Lct APN 1 128300375 missense possibly damaging 0.81
IGL03227:Lct APN 1 128327689 missense probably benign 0.09
R0071:Lct UTSW 1 128292018 nonsense probably null
R0071:Lct UTSW 1 128292018 nonsense probably null
R0135:Lct UTSW 1 128285123 missense probably damaging 0.98
R0145:Lct UTSW 1 128327895 missense probably benign 0.00
R0179:Lct UTSW 1 128327685 missense probably benign
R0331:Lct UTSW 1 128298742 splice site probably benign
R0366:Lct UTSW 1 128286462 missense probably benign 0.03
R0399:Lct UTSW 1 128300525 missense probably damaging 1.00
R0492:Lct UTSW 1 128300582 missense probably damaging 1.00
R0548:Lct UTSW 1 128285195 missense probably damaging 1.00
R0691:Lct UTSW 1 128308234 missense probably benign 0.00
R0755:Lct UTSW 1 128294135 missense possibly damaging 0.46
R0839:Lct UTSW 1 128286609 missense probably benign 0.00
R1128:Lct UTSW 1 128301309 missense probably damaging 0.99
R1135:Lct UTSW 1 128294124 critical splice donor site probably null
R1321:Lct UTSW 1 128300022 missense probably benign
R1448:Lct UTSW 1 128307822 missense probably damaging 0.99
R1450:Lct UTSW 1 128307903 missense probably damaging 1.00
R1572:Lct UTSW 1 128294195 missense probably benign 0.25
R1582:Lct UTSW 1 128300562 missense probably damaging 1.00
R1668:Lct UTSW 1 128287722 splice site probably null
R1757:Lct UTSW 1 128301257 missense probably damaging 1.00
R1775:Lct UTSW 1 128300301 missense probably damaging 1.00
R1792:Lct UTSW 1 128327942 missense possibly damaging 0.54
R1815:Lct UTSW 1 128300159 missense probably damaging 1.00
R1932:Lct UTSW 1 128294161 missense probably damaging 1.00
R2325:Lct UTSW 1 128304226 missense probably damaging 1.00
R2381:Lct UTSW 1 128304121 nonsense probably null
R3001:Lct UTSW 1 128304226 missense probably damaging 1.00
R3002:Lct UTSW 1 128304226 missense probably damaging 1.00
R3003:Lct UTSW 1 128304226 missense probably damaging 1.00
R3011:Lct UTSW 1 128301372 missense possibly damaging 0.74
R3082:Lct UTSW 1 128287608 missense probably damaging 1.00
R3683:Lct UTSW 1 128304226 missense probably damaging 1.00
R3684:Lct UTSW 1 128304226 missense probably damaging 1.00
R3726:Lct UTSW 1 128304226 missense probably damaging 1.00
R3886:Lct UTSW 1 128304226 missense probably damaging 1.00
R3887:Lct UTSW 1 128304226 missense probably damaging 1.00
R3888:Lct UTSW 1 128304226 missense probably damaging 1.00
R4019:Lct UTSW 1 128304226 missense probably damaging 1.00
R4027:Lct UTSW 1 128285181 missense probably benign 0.00
R4226:Lct UTSW 1 128304226 missense probably damaging 1.00
R4409:Lct UTSW 1 128304226 missense probably damaging 1.00
R4514:Lct UTSW 1 128300514 missense probably benign
R4570:Lct UTSW 1 128299904 missense probably benign 0.01
R4776:Lct UTSW 1 128300387 missense probably damaging 0.99
R5001:Lct UTSW 1 128308241 missense probably damaging 0.96
R5021:Lct UTSW 1 128300565 missense probably benign 0.38
R5318:Lct UTSW 1 128304372 missense probably damaging 1.00
R5330:Lct UTSW 1 128298529 missense probably benign 0.06
R5385:Lct UTSW 1 128311617 missense possibly damaging 0.63
R5499:Lct UTSW 1 128286677 missense probably damaging 1.00
R5508:Lct UTSW 1 128294131 missense probably damaging 1.00
R5642:Lct UTSW 1 128295232 missense probably damaging 1.00
R5724:Lct UTSW 1 128300336 missense probably benign
R6026:Lct UTSW 1 128300018 missense probably benign
R6044:Lct UTSW 1 128307980 missense possibly damaging 0.95
R6175:Lct UTSW 1 128327714 missense probably damaging 1.00
R6277:Lct UTSW 1 128304237 missense probably benign 0.01
R6412:Lct UTSW 1 128327718 missense probably benign 0.00
R6480:Lct UTSW 1 128294320 missense probably damaging 1.00
R6526:Lct UTSW 1 128300478 missense probably benign 0.05
R6620:Lct UTSW 1 128295072 critical splice donor site probably null
R7214:Lct UTSW 1 128300460 missense probably benign 0.00
R7308:Lct UTSW 1 128319087 missense probably benign 0.00
X0052:Lct UTSW 1 128307630 missense probably damaging 1.00
YA93:Lct UTSW 1 128301320 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTAGCCTGCATAGCTTATCACCC -3'
(R):5'- TAACCTACAGTAGCCTGGCCCTTC -3'

Sequencing Primer
(F):5'- AGTCCAGCAGGCTGTCAATC -3'
(R):5'- CTTCAGAGCGAGCAGCAG -3'
Posted On2015-02-04