Incidental Mutation 'ANU18:Tmem87a'
ID262524
Institutional Source Beutler Lab
Gene Symbol Tmem87a
Ensembl Gene ENSMUSG00000033808
Gene Nametransmembrane protein 87A
SynonymsA930025J12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #ANU18
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location120355312-120404113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120380769 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 232 (I232V)
Ref Sequence ENSEMBL: ENSMUSP00000106357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090042] [ENSMUST00000090046] [ENSMUST00000110729]
Predicted Effect probably benign
Transcript: ENSMUST00000090042
AA Change: I232V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000087496
Gene: ENSMUSG00000033808
AA Change: I232V

DomainStartEndE-ValueType
Pfam:Lung_7-TM_R 184 471 1.1e-87 PFAM
low complexity region 480 486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090046
AA Change: I232V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000087500
Gene: ENSMUSG00000033808
AA Change: I232V

DomainStartEndE-ValueType
Pfam:Lung_7-TM_R 185 472 1.5e-85 PFAM
low complexity region 481 487 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110729
AA Change: I232V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106357
Gene: ENSMUSG00000033808
AA Change: I232V

DomainStartEndE-ValueType
Pfam:Lung_7-TM_R 184 472 2.4e-86 PFAM
low complexity region 481 487 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151740
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C T 17: 14,943,919 probably null Het
Acacb A T 5: 114,246,498 I2238L probably benign Het
Aldh1l2 T C 10: 83,522,846 Y95C probably damaging Het
Asxl2 A G 12: 3,501,425 T1056A probably damaging Het
B4galnt1 A G 10: 127,169,779 T250A possibly damaging Het
Cela3b A T 4: 137,423,843 probably null Het
Chst3 T C 10: 60,185,832 T398A probably damaging Het
Cngb3 A G 4: 19,425,625 T478A probably damaging Het
Cyp4a10 T C 4: 115,518,455 L45P probably damaging Het
D630003M21Rik A G 2: 158,217,648 S111P probably benign Het
Defb21 A G 2: 152,574,751 E49G possibly damaging Het
Dnajc1 T C 2: 18,308,834 T159A probably damaging Het
Dnmbp A G 19: 43,902,354 S325P probably benign Het
Fam91a1 T C 15: 58,442,871 F534L probably damaging Het
Fermt2 T C 14: 45,464,863 E488G probably damaging Het
Filip1 T C 9: 79,819,180 D719G possibly damaging Het
Gad1-ps A G 10: 99,445,151 noncoding transcript Het
Glra3 C A 8: 55,940,962 A36E probably benign Het
Hnrnpm C T 17: 33,669,168 probably null Het
Lct T A 1: 128,308,047 R408* probably null Het
Lrrk2 T A 15: 91,767,339 Y1733N probably damaging Het
Mindy1 T C 3: 95,288,390 L148P probably damaging Het
Mkrn2 C A 6: 115,611,789 Y164* probably null Het
Msra T C 14: 64,210,435 Y135C probably damaging Het
Ndst3 C T 3: 123,548,916 A749T probably damaging Het
Ngdn G T 14: 55,017,114 A41S probably benign Het
Nlrp12 A T 7: 3,240,092 S597T probably damaging Het
Olfr1451 A T 19: 12,999,417 I144F probably damaging Het
Pabpc6 A G 17: 9,667,970 S551P probably benign Het
Plekhg5 C T 4: 152,112,553 A752V probably benign Het
Prpf4b T C 13: 34,884,291 S368P probably benign Het
Pus7 A G 5: 23,746,424 probably null Het
Rab40b C G 11: 121,357,962 V156L probably benign Het
Slc9a9 T A 9: 95,055,459 S455T probably benign Het
Tmem26 A T 10: 68,778,606 N284Y probably damaging Het
Trpm2 A G 10: 77,923,984 L1106P probably damaging Het
Tshz1 A G 18: 84,014,661 Y541H probably damaging Het
Zfp213 G T 17: 23,561,417 A43D probably benign Het
Zfp365 A G 10: 67,909,354 V198A probably damaging Het
Zfp618 G A 4: 63,132,826 V615M probably damaging Het
Other mutations in Tmem87a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Tmem87a APN 2 120379780 splice site probably benign
IGL00912:Tmem87a APN 2 120403936 missense possibly damaging 0.54
IGL01301:Tmem87a APN 2 120380769 missense probably benign 0.01
IGL01413:Tmem87a APN 2 120385870 missense probably benign 0.06
IGL01418:Tmem87a APN 2 120385870 missense probably benign 0.06
IGL02083:Tmem87a APN 2 120397380 missense probably damaging 1.00
IGL02150:Tmem87a APN 2 120360076 missense probably damaging 0.99
IGL02256:Tmem87a APN 2 120377896 missense probably damaging 1.00
IGL02314:Tmem87a APN 2 120404021 missense possibly damaging 0.57
IGL02501:Tmem87a APN 2 120404053 missense probably damaging 0.98
IGL02550:Tmem87a APN 2 120374485 splice site probably null
IGL03082:Tmem87a APN 2 120397366 missense possibly damaging 0.81
R0254:Tmem87a UTSW 2 120375507 missense probably damaging 1.00
R0285:Tmem87a UTSW 2 120394424 missense probably benign 0.01
R0498:Tmem87a UTSW 2 120394465 missense probably benign 0.01
R0611:Tmem87a UTSW 2 120375448 missense possibly damaging 0.46
R0632:Tmem87a UTSW 2 120359542 missense probably damaging 1.00
R0787:Tmem87a UTSW 2 120370484 missense probably benign 0.22
R1599:Tmem87a UTSW 2 120394387 missense probably damaging 1.00
R1977:Tmem87a UTSW 2 120374504 missense probably benign 0.02
R2059:Tmem87a UTSW 2 120369292 missense probably damaging 1.00
R2396:Tmem87a UTSW 2 120404059 start codon destroyed probably null 0.02
R2496:Tmem87a UTSW 2 120394378 missense probably damaging 0.96
R4478:Tmem87a UTSW 2 120369343 nonsense probably null
R4621:Tmem87a UTSW 2 120397424 missense probably benign 0.00
R4739:Tmem87a UTSW 2 120360037 critical splice donor site probably null
R5138:Tmem87a UTSW 2 120371545 missense possibly damaging 0.88
R5314:Tmem87a UTSW 2 120377926 missense probably damaging 0.99
R5391:Tmem87a UTSW 2 120362877 critical splice donor site probably null
R5536:Tmem87a UTSW 2 120397430 missense probably damaging 0.96
R5618:Tmem87a UTSW 2 120369306 missense probably benign 0.44
R5642:Tmem87a UTSW 2 120403946 missense probably benign 0.00
R5884:Tmem87a UTSW 2 120404124 unclassified probably benign
R6104:Tmem87a UTSW 2 120394424 missense probably benign 0.01
R6158:Tmem87a UTSW 2 120360103 splice site probably null
R6195:Tmem87a UTSW 2 120392175 splice site probably null
R6233:Tmem87a UTSW 2 120392175 splice site probably null
R6261:Tmem87a UTSW 2 120404021 missense possibly damaging 0.57
R6403:Tmem87a UTSW 2 120380771 missense possibly damaging 0.94
R6405:Tmem87a UTSW 2 120379750 missense probably damaging 1.00
R6540:Tmem87a UTSW 2 120403919 missense probably benign 0.00
R6583:Tmem87a UTSW 2 120375477 missense possibly damaging 0.93
R6995:Tmem87a UTSW 2 120362928 missense possibly damaging 0.91
R7081:Tmem87a UTSW 2 120380783 missense possibly damaging 0.88
R7384:Tmem87a UTSW 2 120371523 critical splice donor site probably null
R7558:Tmem87a UTSW 2 120374510 missense probably benign 0.00
R7904:Tmem87a UTSW 2 120379717 missense probably damaging 1.00
R8124:Tmem87a UTSW 2 120392195 missense probably benign
R8165:Tmem87a UTSW 2 120370478 missense possibly damaging 0.95
R8259:Tmem87a UTSW 2 120397447 missense possibly damaging 0.65
R8315:Tmem87a UTSW 2 120403960 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGAGATTCTCCAGGCCACAAGTC -3'
(R):5'- TGTGCTTACAGTCAGTGCTTACAGG -3'

Sequencing Primer
(F):5'- caatgactttgtctaatctctgcc -3'
(R):5'- GGACCTGAGTCTTGAAAAAATCC -3'
Posted On2015-02-04