Incidental Mutation 'ANU18:Defb21'
ID262525
Institutional Source Beutler Lab
Gene Symbol Defb21
Ensembl Gene ENSMUSG00000056544
Gene Namedefensin beta 21
SynonymsLOC228782, 4930525K10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #ANU18
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location152572744-152574944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152574751 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 49 (E49G)
Ref Sequence ENSEMBL: ENSMUSP00000065102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053180] [ENSMUST00000070722]
Predicted Effect probably benign
Transcript: ENSMUST00000053180
SMART Domains Protein: ENSMUSP00000059585
Gene: ENSMUSG00000050645

DomainStartEndE-ValueType
Pfam:Defensin_big 2 60 3.4e-9 PFAM
Pfam:Defensin_beta_2 26 55 5.1e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000070722
AA Change: E49G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065102
Gene: ENSMUSG00000056544
AA Change: E49G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Defensin_beta_2 33 62 1.4e-9 PFAM
low complexity region 76 86 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C T 17: 14,943,919 probably null Het
Acacb A T 5: 114,246,498 I2238L probably benign Het
Aldh1l2 T C 10: 83,522,846 Y95C probably damaging Het
Asxl2 A G 12: 3,501,425 T1056A probably damaging Het
B4galnt1 A G 10: 127,169,779 T250A possibly damaging Het
Cela3b A T 4: 137,423,843 probably null Het
Chst3 T C 10: 60,185,832 T398A probably damaging Het
Cngb3 A G 4: 19,425,625 T478A probably damaging Het
Cyp4a10 T C 4: 115,518,455 L45P probably damaging Het
D630003M21Rik A G 2: 158,217,648 S111P probably benign Het
Dnajc1 T C 2: 18,308,834 T159A probably damaging Het
Dnmbp A G 19: 43,902,354 S325P probably benign Het
Fam91a1 T C 15: 58,442,871 F534L probably damaging Het
Fermt2 T C 14: 45,464,863 E488G probably damaging Het
Filip1 T C 9: 79,819,180 D719G possibly damaging Het
Gad1-ps A G 10: 99,445,151 noncoding transcript Het
Glra3 C A 8: 55,940,962 A36E probably benign Het
Hnrnpm C T 17: 33,669,168 probably null Het
Lct T A 1: 128,308,047 R408* probably null Het
Lrrk2 T A 15: 91,767,339 Y1733N probably damaging Het
Mindy1 T C 3: 95,288,390 L148P probably damaging Het
Mkrn2 C A 6: 115,611,789 Y164* probably null Het
Msra T C 14: 64,210,435 Y135C probably damaging Het
Ndst3 C T 3: 123,548,916 A749T probably damaging Het
Ngdn G T 14: 55,017,114 A41S probably benign Het
Nlrp12 A T 7: 3,240,092 S597T probably damaging Het
Olfr1451 A T 19: 12,999,417 I144F probably damaging Het
Pabpc6 A G 17: 9,667,970 S551P probably benign Het
Plekhg5 C T 4: 152,112,553 A752V probably benign Het
Prpf4b T C 13: 34,884,291 S368P probably benign Het
Pus7 A G 5: 23,746,424 probably null Het
Rab40b C G 11: 121,357,962 V156L probably benign Het
Slc9a9 T A 9: 95,055,459 S455T probably benign Het
Tmem26 A T 10: 68,778,606 N284Y probably damaging Het
Tmem87a T C 2: 120,380,769 I232V probably benign Het
Trpm2 A G 10: 77,923,984 L1106P probably damaging Het
Tshz1 A G 18: 84,014,661 Y541H probably damaging Het
Zfp213 G T 17: 23,561,417 A43D probably benign Het
Zfp365 A G 10: 67,909,354 V198A probably damaging Het
Zfp618 G A 4: 63,132,826 V615M probably damaging Het
Other mutations in Defb21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Defb21 APN 2 152574792 missense probably benign 0.33
IGL00795:Defb21 APN 2 152574745 missense probably benign 0.00
IGL01301:Defb21 APN 2 152574751 missense possibly damaging 0.85
IGL01686:Defb21 APN 2 152574901 unclassified probably benign
R2305:Defb21 UTSW 2 152574871 missense possibly damaging 0.96
R2438:Defb21 UTSW 2 152574775 missense possibly damaging 0.71
R6805:Defb21 UTSW 2 152574869 missense probably benign 0.01
X0063:Defb21 UTSW 2 152573832 unclassified probably benign
Z1176:Defb21 UTSW 2 152573833 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGGAGCAGCTATTTGGAGATGCG -3'
(R):5'- CAGGAGCTGTCAGAAACTTCAGGG -3'

Sequencing Primer
(F):5'- TGGAGATGCGTGGTATTATCAAAC -3'
(R):5'- CTGTCAGAAACTTCAGGGACAGG -3'
Posted On2015-02-04