Incidental Mutation 'ANU18:Zfp618'
ID262531
Institutional Source Beutler Lab
Gene Symbol Zfp618
Ensembl Gene ENSMUSG00000028358
Gene Namezinc finger protein 618
SynonymsD430033D05Rik, 2810040O04Rik, 2810031P15Rik, Nedd10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #ANU18
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location62965573-63139708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 63132826 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 615 (V615M)
Ref Sequence ENSEMBL: ENSMUSP00000103038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064814] [ENSMUST00000107415]
Predicted Effect probably damaging
Transcript: ENSMUST00000064814
AA Change: V522M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069275
Gene: ENSMUSG00000028358
AA Change: V522M

DomainStartEndE-ValueType
ZnF_C2H2 114 136 5.06e-2 SMART
ZnF_C2H2 155 177 8.81e-2 SMART
ZnF_C2H2 243 265 2.91e-2 SMART
low complexity region 288 295 N/A INTRINSIC
ZnF_C2H2 298 320 2.53e-2 SMART
PDB:2BW3|A 377 690 5e-8 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000107415
AA Change: V615M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103038
Gene: ENSMUSG00000028358
AA Change: V615M

DomainStartEndE-ValueType
ZnF_C2H2 146 168 5.06e-2 SMART
ZnF_C2H2 187 209 8.81e-2 SMART
ZnF_C2H2 255 277 2.91e-2 SMART
low complexity region 381 388 N/A INTRINSIC
ZnF_C2H2 391 413 2.53e-2 SMART
PDB:2BW3|A 479 783 9e-8 PDB
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C T 17: 14,943,919 probably null Het
Acacb A T 5: 114,246,498 I2238L probably benign Het
Aldh1l2 T C 10: 83,522,846 Y95C probably damaging Het
Asxl2 A G 12: 3,501,425 T1056A probably damaging Het
B4galnt1 A G 10: 127,169,779 T250A possibly damaging Het
Cela3b A T 4: 137,423,843 probably null Het
Chst3 T C 10: 60,185,832 T398A probably damaging Het
Cngb3 A G 4: 19,425,625 T478A probably damaging Het
Cyp4a10 T C 4: 115,518,455 L45P probably damaging Het
D630003M21Rik A G 2: 158,217,648 S111P probably benign Het
Defb21 A G 2: 152,574,751 E49G possibly damaging Het
Dnajc1 T C 2: 18,308,834 T159A probably damaging Het
Dnmbp A G 19: 43,902,354 S325P probably benign Het
Fam91a1 T C 15: 58,442,871 F534L probably damaging Het
Fermt2 T C 14: 45,464,863 E488G probably damaging Het
Filip1 T C 9: 79,819,180 D719G possibly damaging Het
Gad1-ps A G 10: 99,445,151 noncoding transcript Het
Glra3 C A 8: 55,940,962 A36E probably benign Het
Hnrnpm C T 17: 33,669,168 probably null Het
Lct T A 1: 128,308,047 R408* probably null Het
Lrrk2 T A 15: 91,767,339 Y1733N probably damaging Het
Mindy1 T C 3: 95,288,390 L148P probably damaging Het
Mkrn2 C A 6: 115,611,789 Y164* probably null Het
Msra T C 14: 64,210,435 Y135C probably damaging Het
Ndst3 C T 3: 123,548,916 A749T probably damaging Het
Ngdn G T 14: 55,017,114 A41S probably benign Het
Nlrp12 A T 7: 3,240,092 S597T probably damaging Het
Olfr1451 A T 19: 12,999,417 I144F probably damaging Het
Pabpc6 A G 17: 9,667,970 S551P probably benign Het
Plekhg5 C T 4: 152,112,553 A752V probably benign Het
Prpf4b T C 13: 34,884,291 S368P probably benign Het
Pus7 A G 5: 23,746,424 probably null Het
Rab40b C G 11: 121,357,962 V156L probably benign Het
Slc9a9 T A 9: 95,055,459 S455T probably benign Het
Tmem26 A T 10: 68,778,606 N284Y probably damaging Het
Tmem87a T C 2: 120,380,769 I232V probably benign Het
Trpm2 A G 10: 77,923,984 L1106P probably damaging Het
Tshz1 A G 18: 84,014,661 Y541H probably damaging Het
Zfp213 G T 17: 23,561,417 A43D probably benign Het
Zfp365 A G 10: 67,909,354 V198A probably damaging Het
Other mutations in Zfp618
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Zfp618 APN 4 63132826 missense probably damaging 1.00
IGL01563:Zfp618 APN 4 63079896 missense probably benign 0.38
IGL01726:Zfp618 APN 4 63132635 missense probably damaging 1.00
IGL02139:Zfp618 APN 4 63133536 missense probably damaging 1.00
IGL02182:Zfp618 APN 4 63095561 splice site probably benign
IGL02533:Zfp618 APN 4 63089405 missense probably damaging 1.00
IGL03231:Zfp618 APN 4 63094479 missense probably damaging 1.00
IGL03257:Zfp618 APN 4 63132671 missense probably damaging 1.00
IGL03014:Zfp618 UTSW 4 63080088 missense probably damaging 1.00
R0288:Zfp618 UTSW 4 63132934 missense possibly damaging 0.57
R0408:Zfp618 UTSW 4 63086572 missense probably damaging 0.97
R0685:Zfp618 UTSW 4 63133774 missense probably benign 0.21
R1482:Zfp618 UTSW 4 63115448 missense possibly damaging 0.64
R1585:Zfp618 UTSW 4 63132938 missense probably damaging 1.00
R1649:Zfp618 UTSW 4 63095537 missense probably damaging 1.00
R1744:Zfp618 UTSW 4 63086634 splice site probably benign
R1793:Zfp618 UTSW 4 63133237 missense probably damaging 0.97
R1952:Zfp618 UTSW 4 63132318 splice site probably null
R1996:Zfp618 UTSW 4 63131215 splice site probably null
R3792:Zfp618 UTSW 4 63115491 intron probably benign
R3803:Zfp618 UTSW 4 63133019 missense probably damaging 1.00
R3821:Zfp618 UTSW 4 63133564 missense probably benign 0.00
R3838:Zfp618 UTSW 4 63133564 missense probably benign 0.00
R4009:Zfp618 UTSW 4 63133564 missense probably benign 0.00
R4010:Zfp618 UTSW 4 63133564 missense probably benign 0.00
R4565:Zfp618 UTSW 4 63121351 missense probably damaging 1.00
R4611:Zfp618 UTSW 4 63132979 missense probably damaging 1.00
R5019:Zfp618 UTSW 4 63103552 missense probably damaging 1.00
R5154:Zfp618 UTSW 4 63133209 missense probably damaging 1.00
R5183:Zfp618 UTSW 4 63099282 missense probably benign
R5354:Zfp618 UTSW 4 63080028 missense probably damaging 1.00
R5383:Zfp618 UTSW 4 63095492 missense probably benign 0.33
R5774:Zfp618 UTSW 4 63132562 missense probably damaging 1.00
R5932:Zfp618 UTSW 4 63118566 nonsense probably null
R6101:Zfp618 UTSW 4 63133241 missense probably benign 0.09
R6105:Zfp618 UTSW 4 63133241 missense probably benign 0.09
R6478:Zfp618 UTSW 4 63132706 missense probably damaging 1.00
R6598:Zfp618 UTSW 4 63089399 missense probably damaging 1.00
R7386:Zfp618 UTSW 4 63095385 critical splice donor site probably null
R7666:Zfp618 UTSW 4 63132717 nonsense probably null
R7678:Zfp618 UTSW 4 63086621 missense probably benign 0.07
R8276:Zfp618 UTSW 4 63132956 missense probably damaging 1.00
X0011:Zfp618 UTSW 4 63080006 missense probably damaging 0.99
Z1176:Zfp618 UTSW 4 63095497 missense probably benign 0.29
Z1176:Zfp618 UTSW 4 63132763 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TTGGGCAATTTTAACACCTTGGCAC -3'
(R):5'- TAGGTCCTCACACACGTTGAGCAG -3'

Sequencing Primer
(F):5'- TTTAACACCTTGGCACTGAAGC -3'
(R):5'- TTGAGCAGCTCGATGACCTC -3'
Posted On2015-02-04