Incidental Mutation 'ANU18:Filip1'
ID 262542
Institutional Source Beutler Lab
Gene Symbol Filip1
Ensembl Gene ENSMUSG00000034898
Gene Name filamin A interacting protein 1
Synonyms FILIP, 5730485H21Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.499) question?
Stock # ANU18
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 79712376-79920133 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79726462 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 719 (D719G)
Ref Sequence ENSEMBL: ENSMUSP00000091329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000093811
AA Change: D719G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: D719G

DomainStartEndE-ValueType
Pfam:CortBP2 71 256 2.1e-64 PFAM
coiled coil region 258 540 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 579 592 N/A INTRINSIC
coiled coil region 625 778 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1198 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172740
Predicted Effect probably benign
Transcript: ENSMUST00000172973
SMART Domains Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

DomainStartEndE-ValueType
Pfam:CortBP2 65 225 5.2e-74 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C T 17: 15,164,181 (GRCm39) probably null Het
Acacb A T 5: 114,384,559 (GRCm39) I2238L probably benign Het
Aldh1l2 T C 10: 83,358,710 (GRCm39) Y95C probably damaging Het
Asxl2 A G 12: 3,551,425 (GRCm39) T1056A probably damaging Het
B4galnt1 A G 10: 127,005,648 (GRCm39) T250A possibly damaging Het
Cela3b A T 4: 137,151,154 (GRCm39) probably null Het
Chst3 T C 10: 60,021,654 (GRCm39) T398A probably damaging Het
Cngb3 A G 4: 19,425,625 (GRCm39) T478A probably damaging Het
Cyp4a10 T C 4: 115,375,652 (GRCm39) L45P probably damaging Het
D630003M21Rik A G 2: 158,059,568 (GRCm39) S111P probably benign Het
Defb21 A G 2: 152,416,671 (GRCm39) E49G possibly damaging Het
Dnajc1 T C 2: 18,313,645 (GRCm39) T159A probably damaging Het
Dnmbp A G 19: 43,890,793 (GRCm39) S325P probably benign Het
Fam91a1 T C 15: 58,314,720 (GRCm39) F534L probably damaging Het
Fermt2 T C 14: 45,702,320 (GRCm39) E488G probably damaging Het
Gad1-ps A G 10: 99,281,013 (GRCm39) noncoding transcript Het
Glra3 C A 8: 56,393,997 (GRCm39) A36E probably benign Het
Hnrnpm C T 17: 33,888,142 (GRCm39) probably null Het
Lct T A 1: 128,235,784 (GRCm39) R408* probably null Het
Lrrk2 T A 15: 91,651,542 (GRCm39) Y1733N probably damaging Het
Mindy1 T C 3: 95,195,701 (GRCm39) L148P probably damaging Het
Mkrn2 C A 6: 115,588,750 (GRCm39) Y164* probably null Het
Msra T C 14: 64,447,884 (GRCm39) Y135C probably damaging Het
Ndst3 C T 3: 123,342,565 (GRCm39) A749T probably damaging Het
Ngdn G T 14: 55,254,571 (GRCm39) A41S probably benign Het
Nlrp12 A T 7: 3,288,722 (GRCm39) S597T probably damaging Het
Or5b99 A T 19: 12,976,781 (GRCm39) I144F probably damaging Het
Pabpc6 A G 17: 9,886,899 (GRCm39) S551P probably benign Het
Plekhg5 C T 4: 152,197,010 (GRCm39) A752V probably benign Het
Prpf4b T C 13: 35,068,274 (GRCm39) S368P probably benign Het
Pus7 A G 5: 23,951,422 (GRCm39) probably null Het
Rab40b C G 11: 121,248,788 (GRCm39) V156L probably benign Het
Slc9a9 T A 9: 94,937,512 (GRCm39) S455T probably benign Het
Tmem26 A T 10: 68,614,436 (GRCm39) N284Y probably damaging Het
Tmem87a T C 2: 120,211,250 (GRCm39) I232V probably benign Het
Trpm2 A G 10: 77,759,818 (GRCm39) L1106P probably damaging Het
Tshz1 A G 18: 84,032,786 (GRCm39) Y541H probably damaging Het
Zfp213 G T 17: 23,780,391 (GRCm39) A43D probably benign Het
Zfp365 A G 10: 67,745,184 (GRCm39) V198A probably damaging Het
Zfp618 G A 4: 63,051,063 (GRCm39) V615M probably damaging Het
Other mutations in Filip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Filip1 APN 9 79,725,226 (GRCm39) missense probably damaging 1.00
IGL01101:Filip1 APN 9 79,805,528 (GRCm39) missense probably benign 0.44
IGL01301:Filip1 APN 9 79,726,462 (GRCm39) missense possibly damaging 0.93
IGL01887:Filip1 APN 9 79,726,899 (GRCm39) missense probably benign 0.42
IGL02119:Filip1 APN 9 79,725,548 (GRCm39) missense probably benign
IGL02285:Filip1 APN 9 79,727,408 (GRCm39) missense probably damaging 1.00
IGL02395:Filip1 APN 9 79,805,692 (GRCm39) missense probably benign 0.01
IGL03398:Filip1 APN 9 79,726,225 (GRCm39) missense probably benign 0.03
IGL03400:Filip1 APN 9 79,727,755 (GRCm39) missense probably benign 0.01
IGL03404:Filip1 APN 9 79,725,841 (GRCm39) missense probably damaging 0.99
BB010:Filip1 UTSW 9 79,727,329 (GRCm39) missense possibly damaging 0.65
BB020:Filip1 UTSW 9 79,727,329 (GRCm39) missense possibly damaging 0.65
R0101:Filip1 UTSW 9 79,726,810 (GRCm39) missense probably benign 0.04
R0243:Filip1 UTSW 9 79,726,285 (GRCm39) missense probably damaging 0.98
R0244:Filip1 UTSW 9 79,726,744 (GRCm39) missense possibly damaging 0.87
R0371:Filip1 UTSW 9 79,767,373 (GRCm39) missense probably damaging 1.00
R0399:Filip1 UTSW 9 79,725,592 (GRCm39) missense possibly damaging 0.71
R0412:Filip1 UTSW 9 79,727,571 (GRCm39) missense possibly damaging 0.59
R0671:Filip1 UTSW 9 79,726,672 (GRCm39) missense probably damaging 1.00
R1314:Filip1 UTSW 9 79,727,848 (GRCm39) missense probably damaging 1.00
R1465:Filip1 UTSW 9 79,805,589 (GRCm39) missense probably benign 0.25
R1465:Filip1 UTSW 9 79,805,589 (GRCm39) missense probably benign 0.25
R1602:Filip1 UTSW 9 79,727,873 (GRCm39) missense probably damaging 0.99
R1801:Filip1 UTSW 9 79,723,128 (GRCm39) missense probably damaging 0.98
R1929:Filip1 UTSW 9 79,727,212 (GRCm39) missense probably damaging 1.00
R1983:Filip1 UTSW 9 79,767,374 (GRCm39) missense probably damaging 1.00
R2066:Filip1 UTSW 9 79,727,498 (GRCm39) missense probably damaging 1.00
R2128:Filip1 UTSW 9 79,726,612 (GRCm39) missense probably damaging 0.99
R2271:Filip1 UTSW 9 79,727,212 (GRCm39) missense probably damaging 1.00
R2411:Filip1 UTSW 9 79,805,715 (GRCm39) missense probably damaging 0.98
R3429:Filip1 UTSW 9 79,760,952 (GRCm39) missense probably damaging 1.00
R3430:Filip1 UTSW 9 79,760,952 (GRCm39) missense probably damaging 1.00
R3945:Filip1 UTSW 9 79,725,649 (GRCm39) missense probably benign 0.01
R4007:Filip1 UTSW 9 79,726,009 (GRCm39) missense possibly damaging 0.71
R4583:Filip1 UTSW 9 79,723,091 (GRCm39) missense possibly damaging 0.76
R4803:Filip1 UTSW 9 79,727,396 (GRCm39) missense probably benign 0.05
R4837:Filip1 UTSW 9 79,726,741 (GRCm39) missense probably damaging 0.98
R4910:Filip1 UTSW 9 79,725,214 (GRCm39) missense probably benign 0.00
R4929:Filip1 UTSW 9 79,727,029 (GRCm39) missense probably benign 0.07
R5387:Filip1 UTSW 9 79,725,556 (GRCm39) missense probably benign
R5581:Filip1 UTSW 9 79,727,042 (GRCm39) missense possibly damaging 0.95
R5808:Filip1 UTSW 9 79,725,983 (GRCm39) missense possibly damaging 0.67
R5891:Filip1 UTSW 9 79,727,142 (GRCm39) missense possibly damaging 0.69
R6166:Filip1 UTSW 9 79,726,736 (GRCm39) missense probably damaging 0.99
R6273:Filip1 UTSW 9 79,723,168 (GRCm39) missense probably benign 0.01
R6380:Filip1 UTSW 9 79,726,906 (GRCm39) missense probably damaging 0.99
R6385:Filip1 UTSW 9 79,727,813 (GRCm39) missense possibly damaging 0.68
R6614:Filip1 UTSW 9 79,723,121 (GRCm39) missense probably damaging 1.00
R6715:Filip1 UTSW 9 79,726,040 (GRCm39) missense probably benign 0.03
R7047:Filip1 UTSW 9 79,760,916 (GRCm39) missense probably damaging 0.98
R7126:Filip1 UTSW 9 79,805,577 (GRCm39) missense possibly damaging 0.88
R7144:Filip1 UTSW 9 79,727,495 (GRCm39) missense possibly damaging 0.65
R7218:Filip1 UTSW 9 79,725,356 (GRCm39) missense probably benign
R7404:Filip1 UTSW 9 79,727,380 (GRCm39) missense possibly damaging 0.94
R7702:Filip1 UTSW 9 79,727,931 (GRCm39) missense probably benign 0.20
R7866:Filip1 UTSW 9 79,726,225 (GRCm39) missense probably benign 0.03
R7933:Filip1 UTSW 9 79,727,329 (GRCm39) missense possibly damaging 0.65
R8012:Filip1 UTSW 9 79,725,241 (GRCm39) missense probably damaging 0.97
R8097:Filip1 UTSW 9 79,725,541 (GRCm39) missense probably benign
R8213:Filip1 UTSW 9 79,725,374 (GRCm39) missense probably benign 0.01
R8305:Filip1 UTSW 9 79,727,757 (GRCm39) nonsense probably null
R8798:Filip1 UTSW 9 79,727,372 (GRCm39) missense possibly damaging 0.94
R9184:Filip1 UTSW 9 79,805,542 (GRCm39) missense probably benign 0.03
R9322:Filip1 UTSW 9 79,727,014 (GRCm39) missense probably benign 0.01
R9334:Filip1 UTSW 9 79,725,739 (GRCm39) missense probably benign 0.32
R9353:Filip1 UTSW 9 79,725,623 (GRCm39) missense possibly damaging 0.67
R9541:Filip1 UTSW 9 79,727,135 (GRCm39) nonsense probably null
R9607:Filip1 UTSW 9 79,726,402 (GRCm39) missense probably damaging 1.00
X0054:Filip1 UTSW 9 79,726,817 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGCTTGGAAAGCTCCAGCTCTTTG -3'
(R):5'- ACTGACGCTTGAAATCGAGAGACTG -3'

Sequencing Primer
(F):5'- TGGTCAGGTTGAGGACCTCC -3'
(R):5'- GACTGAAGAAGCGGCTCC -3'
Posted On 2015-02-04