Mutagenetix > Incidental Mutation

Incidental Mutation 'ANU18:Filip1'

262542

Institutional Source

Beutler Lab

Gene Symbol

Filip1

Ensembl Gene

ENSMUSG00000034898

Gene Name

filamin A interacting protein 1

Synonyms

5730485H21Rik

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.630) question?

Stock #

ANU18

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79815051-80012851 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79819180 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 719 (D719G)

Ref Sequence

ENSEMBL: ENSMUSP00000091329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000093811
AA Change: D719G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: D719G

Domain	Start	End	E-Value	Type
Pfam:CortBP2	71	256	2.1e-64	PFAM
coiled coil region	258	540	N/A	INTRINSIC
low complexity region	545	564	N/A	INTRINSIC
low complexity region	579	592	N/A	INTRINSIC
coiled coil region	625	778	N/A	INTRINSIC
low complexity region	928	940	N/A	INTRINSIC
low complexity region	1126	1140	N/A	INTRINSIC
low complexity region	1168	1180	N/A	INTRINSIC
low complexity region	1198	1214	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172740

Predicted Effect

probably benign
Transcript: ENSMUST00000172973

SMART Domains

Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

Domain	Start	End	E-Value	Type
Pfam:CortBP2	65	225	5.2e-74	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012H06Rik	C	T	17: 14,943,919		probably null	Het
Acacb	A	T	5: 114,246,498	I2238L	probably benign	Het
Aldh1l2	T	C	10: 83,522,846	Y95C	probably damaging	Het
Asxl2	A	G	12: 3,501,425	T1056A	probably damaging	Het
B4galnt1	A	G	10: 127,169,779	T250A	possibly damaging	Het
Cela3b	A	T	4: 137,423,843		probably null	Het
Chst3	T	C	10: 60,185,832	T398A	probably damaging	Het
Cngb3	A	G	4: 19,425,625	T478A	probably damaging	Het
Cyp4a10	T	C	4: 115,518,455	L45P	probably damaging	Het
D630003M21Rik	A	G	2: 158,217,648	S111P	probably benign	Het
Defb21	A	G	2: 152,574,751	E49G	possibly damaging	Het
Dnajc1	T	C	2: 18,308,834	T159A	probably damaging	Het
Dnmbp	A	G	19: 43,902,354	S325P	probably benign	Het
Fam91a1	T	C	15: 58,442,871	F534L	probably damaging	Het
Fermt2	T	C	14: 45,464,863	E488G	probably damaging	Het
Gad1-ps	A	G	10: 99,445,151		noncoding transcript	Het
Glra3	C	A	8: 55,940,962	A36E	probably benign	Het
Hnrnpm	C	T	17: 33,669,168		probably null	Het
Lct	T	A	1: 128,308,047	R408*	probably null	Het
Lrrk2	T	A	15: 91,767,339	Y1733N	probably damaging	Het
Mindy1	T	C	3: 95,288,390	L148P	probably damaging	Het
Mkrn2	C	A	6: 115,611,789	Y164*	probably null	Het
Msra	T	C	14: 64,210,435	Y135C	probably damaging	Het
Ndst3	C	T	3: 123,548,916	A749T	probably damaging	Het
Ngdn	G	T	14: 55,017,114	A41S	probably benign	Het
Nlrp12	A	T	7: 3,240,092	S597T	probably damaging	Het
Olfr1451	A	T	19: 12,999,417	I144F	probably damaging	Het
Pabpc6	A	G	17: 9,667,970	S551P	probably benign	Het
Plekhg5	C	T	4: 152,112,553	A752V	probably benign	Het
Prpf4b	T	C	13: 34,884,291	S368P	probably benign	Het
Pus7	A	G	5: 23,746,424		probably null	Het
Rab40b	C	G	11: 121,357,962	V156L	probably benign	Het
Slc9a9	T	A	9: 95,055,459	S455T	probably benign	Het
Tmem26	A	T	10: 68,778,606	N284Y	probably damaging	Het
Tmem87a	T	C	2: 120,380,769	I232V	probably benign	Het
Trpm2	A	G	10: 77,923,984	L1106P	probably damaging	Het
Tshz1	A	G	18: 84,014,661	Y541H	probably damaging	Het
Zfp213	G	T	17: 23,561,417	A43D	probably benign	Het
Zfp365	A	G	10: 67,909,354	V198A	probably damaging	Het
Zfp618	G	A	4: 63,132,826	V615M	probably damaging	Het

Other mutations in Filip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Filip1	APN	9	79817944	missense	probably damaging	1.00
IGL01101:Filip1	APN	9	79898246	missense	probably benign	0.44
IGL01301:Filip1	APN	9	79819180	missense	possibly damaging	0.93
IGL01887:Filip1	APN	9	79819617	missense	probably benign	0.42
IGL02119:Filip1	APN	9	79818266	missense	probably benign
IGL02285:Filip1	APN	9	79820126	missense	probably damaging	1.00
IGL02395:Filip1	APN	9	79898410	missense	probably benign	0.01
IGL03398:Filip1	APN	9	79818943	missense	probably benign	0.03
IGL03400:Filip1	APN	9	79820473	missense	probably benign	0.01
IGL03404:Filip1	APN	9	79818559	missense	probably damaging	0.99
BB010:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
BB020:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R0101:Filip1	UTSW	9	79819528	missense	probably benign	0.04
R0243:Filip1	UTSW	9	79819003	missense	probably damaging	0.98
R0244:Filip1	UTSW	9	79819462	missense	possibly damaging	0.87
R0371:Filip1	UTSW	9	79860091	missense	probably damaging	1.00
R0399:Filip1	UTSW	9	79818310	missense	possibly damaging	0.71
R0412:Filip1	UTSW	9	79820289	missense	possibly damaging	0.59
R0671:Filip1	UTSW	9	79819390	missense	probably damaging	1.00
R1314:Filip1	UTSW	9	79820566	missense	probably damaging	1.00
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1602:Filip1	UTSW	9	79820591	missense	probably damaging	0.99
R1801:Filip1	UTSW	9	79815846	missense	probably damaging	0.98
R1929:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R1983:Filip1	UTSW	9	79860092	missense	probably damaging	1.00
R2066:Filip1	UTSW	9	79820216	missense	probably damaging	1.00
R2128:Filip1	UTSW	9	79819330	missense	probably damaging	0.99
R2271:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R2411:Filip1	UTSW	9	79898433	missense	probably damaging	0.98
R3429:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3430:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3945:Filip1	UTSW	9	79818367	missense	probably benign	0.01
R4007:Filip1	UTSW	9	79818727	missense	possibly damaging	0.71
R4583:Filip1	UTSW	9	79815809	missense	possibly damaging	0.76
R4803:Filip1	UTSW	9	79820114	missense	probably benign	0.05
R4837:Filip1	UTSW	9	79819459	missense	probably damaging	0.98
R4910:Filip1	UTSW	9	79817932	missense	probably benign	0.00
R4929:Filip1	UTSW	9	79819747	missense	probably benign	0.07
R5387:Filip1	UTSW	9	79818274	missense	probably benign
R5581:Filip1	UTSW	9	79819760	missense	possibly damaging	0.95
R5808:Filip1	UTSW	9	79818701	missense	possibly damaging	0.67
R5891:Filip1	UTSW	9	79819860	missense	possibly damaging	0.69
R6166:Filip1	UTSW	9	79819454	missense	probably damaging	0.99
R6273:Filip1	UTSW	9	79815886	missense	probably benign	0.01
R6380:Filip1	UTSW	9	79819624	missense	probably damaging	0.99
R6385:Filip1	UTSW	9	79820531	missense	possibly damaging	0.68
R6614:Filip1	UTSW	9	79815839	missense	probably damaging	1.00
R6715:Filip1	UTSW	9	79818758	missense	probably benign	0.03
R7047:Filip1	UTSW	9	79853634	missense	probably damaging	0.98
R7126:Filip1	UTSW	9	79898295	missense	possibly damaging	0.88
R7144:Filip1	UTSW	9	79820213	missense	possibly damaging	0.65
R7218:Filip1	UTSW	9	79818074	missense	probably benign
R7404:Filip1	UTSW	9	79820098	missense	possibly damaging	0.94
R7702:Filip1	UTSW	9	79820649	missense	probably benign	0.20
R7866:Filip1	UTSW	9	79818943	missense	probably benign	0.03
R7933:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R8012:Filip1	UTSW	9	79817959	missense	probably damaging	0.97
R8097:Filip1	UTSW	9	79818259	missense	probably benign
R8213:Filip1	UTSW	9	79818092	missense	probably benign	0.01
R8305:Filip1	UTSW	9	79820475	nonsense	probably null
R8798:Filip1	UTSW	9	79820090	missense	possibly damaging	0.94
R9184:Filip1	UTSW	9	79898260	missense	probably benign	0.03
R9322:Filip1	UTSW	9	79819732	missense	probably benign	0.01
R9334:Filip1	UTSW	9	79818457	missense	probably benign	0.32
R9353:Filip1	UTSW	9	79818341	missense	possibly damaging	0.67
R9541:Filip1	UTSW	9	79819853	nonsense	probably null
X0054:Filip1	UTSW	9	79819535	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CGCTTGGAAAGCTCCAGCTCTTTG -3'
(R):5'- ACTGACGCTTGAAATCGAGAGACTG -3'

Sequencing Primer
(F):5'- TGGTCAGGTTGAGGACCTCC -3'
(R):5'- GACTGAAGAAGCGGCTCC -3'

Posted On

2015-02-04