Incidental Mutation 'ANU18:Ngdn'
ID262555
Institutional Source Beutler Lab
Gene Symbol Ngdn
Ensembl Gene ENSMUSG00000022204
Gene Nameneuroguidin, EIF4E binding protein
Synonyms1500001L15Rik, Ngd, neuroguidin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #ANU18
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55015454-55024137 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55017114 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 41 (A41S)
Ref Sequence ENSEMBL: ENSMUSP00000022815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022815]
Predicted Effect probably benign
Transcript: ENSMUST00000022815
AA Change: A41S

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022815
Gene: ENSMUSG00000022204
AA Change: A41S

DomainStartEndE-ValueType
Pfam:Sas10_Utp3 18 98 1.3e-18 PFAM
low complexity region 142 170 N/A INTRINSIC
low complexity region 296 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227833
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neuroguidin is an EIF4E (MIM 133440)-binding protein that interacts with CPEB (MIM 607342) and functions as a translational regulatory protein during development of the vertebrate nervous system (Jung et al., 2006 [PubMed 16705177]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C T 17: 14,943,919 probably null Het
Acacb A T 5: 114,246,498 I2238L probably benign Het
Aldh1l2 T C 10: 83,522,846 Y95C probably damaging Het
Asxl2 A G 12: 3,501,425 T1056A probably damaging Het
B4galnt1 A G 10: 127,169,779 T250A possibly damaging Het
Cela3b A T 4: 137,423,843 probably null Het
Chst3 T C 10: 60,185,832 T398A probably damaging Het
Cngb3 A G 4: 19,425,625 T478A probably damaging Het
Cyp4a10 T C 4: 115,518,455 L45P probably damaging Het
D630003M21Rik A G 2: 158,217,648 S111P probably benign Het
Defb21 A G 2: 152,574,751 E49G possibly damaging Het
Dnajc1 T C 2: 18,308,834 T159A probably damaging Het
Dnmbp A G 19: 43,902,354 S325P probably benign Het
Fam91a1 T C 15: 58,442,871 F534L probably damaging Het
Fermt2 T C 14: 45,464,863 E488G probably damaging Het
Filip1 T C 9: 79,819,180 D719G possibly damaging Het
Gad1-ps A G 10: 99,445,151 noncoding transcript Het
Glra3 C A 8: 55,940,962 A36E probably benign Het
Hnrnpm C T 17: 33,669,168 probably null Het
Lct T A 1: 128,308,047 R408* probably null Het
Lrrk2 T A 15: 91,767,339 Y1733N probably damaging Het
Mindy1 T C 3: 95,288,390 L148P probably damaging Het
Mkrn2 C A 6: 115,611,789 Y164* probably null Het
Msra T C 14: 64,210,435 Y135C probably damaging Het
Ndst3 C T 3: 123,548,916 A749T probably damaging Het
Nlrp12 A T 7: 3,240,092 S597T probably damaging Het
Olfr1451 A T 19: 12,999,417 I144F probably damaging Het
Pabpc6 A G 17: 9,667,970 S551P probably benign Het
Plekhg5 C T 4: 152,112,553 A752V probably benign Het
Prpf4b T C 13: 34,884,291 S368P probably benign Het
Pus7 A G 5: 23,746,424 probably null Het
Rab40b C G 11: 121,357,962 V156L probably benign Het
Slc9a9 T A 9: 95,055,459 S455T probably benign Het
Tmem26 A T 10: 68,778,606 N284Y probably damaging Het
Tmem87a T C 2: 120,380,769 I232V probably benign Het
Trpm2 A G 10: 77,923,984 L1106P probably damaging Het
Tshz1 A G 18: 84,014,661 Y541H probably damaging Het
Zfp213 G T 17: 23,561,417 A43D probably benign Het
Zfp365 A G 10: 67,909,354 V198A probably damaging Het
Zfp618 G A 4: 63,132,826 V615M probably damaging Het
Other mutations in Ngdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Ngdn APN 14 55023169 missense probably damaging 0.99
IGL01301:Ngdn APN 14 55017114 missense probably benign 0.15
IGL02350:Ngdn APN 14 55021936 missense probably damaging 1.00
IGL02357:Ngdn APN 14 55021936 missense probably damaging 1.00
PIT4651001:Ngdn UTSW 14 55016200 missense probably benign 0.05
R2062:Ngdn UTSW 14 55022107 missense possibly damaging 0.93
R2251:Ngdn UTSW 14 55023395 critical splice donor site probably null
R5167:Ngdn UTSW 14 55022199 nonsense probably null
R5492:Ngdn UTSW 14 55023052 missense probably benign 0.00
R6174:Ngdn UTSW 14 55022099 missense probably benign 0.38
R6712:Ngdn UTSW 14 55016188 missense probably benign 0.18
R7866:Ngdn UTSW 14 55021097 missense probably damaging 1.00
R8303:Ngdn UTSW 14 55023145 missense probably benign 0.01
X0025:Ngdn UTSW 14 55021915 missense possibly damaging 0.71
Z1177:Ngdn UTSW 14 55021944 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTGTTCAGCAACAGCGTTTC -3'
(R):5'- TGGTCTGCAATTCTTGCCAGACTC -3'

Sequencing Primer
(F):5'- CAGCGTTTCAGATCATTTTTTAGGC -3'
(R):5'- AGGAGGTCCTCCCTCTTCAAG -3'
Posted On2015-02-04