Incidental Mutation 'ANU18:Fam91a1'
ID262558
Institutional Source Beutler Lab
Gene Symbol Fam91a1
Ensembl Gene ENSMUSG00000037119
Gene Namefamily with sequence similarity 91, member A1
SynonymsD15Ertd621e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #ANU18
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location58415468-58457740 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58442871 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 534 (F534L)
Ref Sequence ENSEMBL: ENSMUSP00000036524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037270]
Predicted Effect probably damaging
Transcript: ENSMUST00000037270
AA Change: F534L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036524
Gene: ENSMUSG00000037119
AA Change: F534L

DomainStartEndE-ValueType
Pfam:FAM91_N 8 312 2.8e-149 PFAM
Pfam:FAM91_C 374 821 3.8e-182 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228576
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C T 17: 14,943,919 probably null Het
Acacb A T 5: 114,246,498 I2238L probably benign Het
Aldh1l2 T C 10: 83,522,846 Y95C probably damaging Het
Asxl2 A G 12: 3,501,425 T1056A probably damaging Het
B4galnt1 A G 10: 127,169,779 T250A possibly damaging Het
Cela3b A T 4: 137,423,843 probably null Het
Chst3 T C 10: 60,185,832 T398A probably damaging Het
Cngb3 A G 4: 19,425,625 T478A probably damaging Het
Cyp4a10 T C 4: 115,518,455 L45P probably damaging Het
D630003M21Rik A G 2: 158,217,648 S111P probably benign Het
Defb21 A G 2: 152,574,751 E49G possibly damaging Het
Dnajc1 T C 2: 18,308,834 T159A probably damaging Het
Dnmbp A G 19: 43,902,354 S325P probably benign Het
Fermt2 T C 14: 45,464,863 E488G probably damaging Het
Filip1 T C 9: 79,819,180 D719G possibly damaging Het
Gad1-ps A G 10: 99,445,151 noncoding transcript Het
Glra3 C A 8: 55,940,962 A36E probably benign Het
Hnrnpm C T 17: 33,669,168 probably null Het
Lct T A 1: 128,308,047 R408* probably null Het
Lrrk2 T A 15: 91,767,339 Y1733N probably damaging Het
Mindy1 T C 3: 95,288,390 L148P probably damaging Het
Mkrn2 C A 6: 115,611,789 Y164* probably null Het
Msra T C 14: 64,210,435 Y135C probably damaging Het
Ndst3 C T 3: 123,548,916 A749T probably damaging Het
Ngdn G T 14: 55,017,114 A41S probably benign Het
Nlrp12 A T 7: 3,240,092 S597T probably damaging Het
Olfr1451 A T 19: 12,999,417 I144F probably damaging Het
Pabpc6 A G 17: 9,667,970 S551P probably benign Het
Plekhg5 C T 4: 152,112,553 A752V probably benign Het
Prpf4b T C 13: 34,884,291 S368P probably benign Het
Pus7 A G 5: 23,746,424 probably null Het
Rab40b C G 11: 121,357,962 V156L probably benign Het
Slc9a9 T A 9: 95,055,459 S455T probably benign Het
Tmem26 A T 10: 68,778,606 N284Y probably damaging Het
Tmem87a T C 2: 120,380,769 I232V probably benign Het
Trpm2 A G 10: 77,923,984 L1106P probably damaging Het
Tshz1 A G 18: 84,014,661 Y541H probably damaging Het
Zfp213 G T 17: 23,561,417 A43D probably benign Het
Zfp365 A G 10: 67,909,354 V198A probably damaging Het
Zfp618 G A 4: 63,132,826 V615M probably damaging Het
Other mutations in Fam91a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Fam91a1 APN 15 58430735 missense probably damaging 0.99
IGL00590:Fam91a1 APN 15 58415716 missense possibly damaging 0.66
IGL01301:Fam91a1 APN 15 58442871 missense probably damaging 0.99
IGL01372:Fam91a1 APN 15 58430062 missense probably damaging 1.00
IGL01979:Fam91a1 APN 15 58432584 missense probably damaging 1.00
IGL02085:Fam91a1 APN 15 58441656 missense possibly damaging 0.95
IGL02553:Fam91a1 APN 15 58432982 critical splice donor site probably null
IGL02605:Fam91a1 APN 15 58431196 splice site probably benign
IGL02882:Fam91a1 APN 15 58453061 splice site probably benign
IGL02894:Fam91a1 APN 15 58443231 missense probably benign 0.09
H8562:Fam91a1 UTSW 15 58427121 splice site probably null
R0395:Fam91a1 UTSW 15 58454792 missense probably benign
R1165:Fam91a1 UTSW 15 58430669 missense possibly damaging 0.90
R1699:Fam91a1 UTSW 15 58432948 missense probably benign 0.04
R1749:Fam91a1 UTSW 15 58426594 missense probably benign 0.02
R1997:Fam91a1 UTSW 15 58424195 critical splice acceptor site probably null
R2042:Fam91a1 UTSW 15 58426594 missense probably benign 0.02
R2188:Fam91a1 UTSW 15 58430663 missense probably damaging 0.98
R2518:Fam91a1 UTSW 15 58450600 missense possibly damaging 0.92
R3124:Fam91a1 UTSW 15 58421889 missense probably benign 0.34
R3916:Fam91a1 UTSW 15 58430734 missense probably damaging 1.00
R4810:Fam91a1 UTSW 15 58434740 missense probably damaging 1.00
R4959:Fam91a1 UTSW 15 58431210 missense probably benign 0.16
R4973:Fam91a1 UTSW 15 58431210 missense probably benign 0.16
R5288:Fam91a1 UTSW 15 58448394 missense probably benign
R5385:Fam91a1 UTSW 15 58448394 missense probably benign
R5386:Fam91a1 UTSW 15 58448394 missense probably benign
R5941:Fam91a1 UTSW 15 58431317 missense probably benign 0.01
R6415:Fam91a1 UTSW 15 58442917 missense probably damaging 1.00
R6869:Fam91a1 UTSW 15 58431268 missense probably benign 0.00
R7175:Fam91a1 UTSW 15 58430678 missense probably benign 0.06
R7872:Fam91a1 UTSW 15 58448360 missense probably benign 0.01
X0024:Fam91a1 UTSW 15 58430189 missense probably damaging 0.98
Z1177:Fam91a1 UTSW 15 58432548 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CATGAGGAAGTTACTAGCCAGGCAC -3'
(R):5'- TTTGAAGCAGGAACGACCCCAG -3'

Sequencing Primer
(F):5'- tgatggagcaaatgaggcac -3'
(R):5'- Cagtgtttgcccaacatgc -3'
Posted On2015-02-04