Incidental Mutation 'ANU18:Zfp213'
ID262562
Institutional Source Beutler Lab
Gene Symbol Zfp213
Ensembl Gene ENSMUSG00000071256
Gene Namezinc finger protein 213
SynonymsD17Ertd197e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #ANU18
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location23556769-23564226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23561417 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 43 (A43D)
Ref Sequence ENSEMBL: ENSMUSP00000093266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095606]
Predicted Effect probably benign
Transcript: ENSMUST00000095606
AA Change: A43D

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000093266
Gene: ENSMUSG00000071256
AA Change: A43D

DomainStartEndE-ValueType
SCAN 41 145 3.11e-56 SMART
KRAB 213 278 3.21e-4 SMART
ZnF_C2H2 326 348 3.89e-3 SMART
ZnF_C2H2 354 376 9.88e-5 SMART
ZnF_C2H2 382 404 6.42e-4 SMART
ZnF_C2H2 410 432 1.95e-3 SMART
ZnF_C2H2 438 460 4.4e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180920
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C2H2 zinc finger proteins, such as ZNF213, have bipartite structures in which one domain binds DNA or RNA and the other modulates target gene expression.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C T 17: 14,943,919 probably null Het
Acacb A T 5: 114,246,498 I2238L probably benign Het
Aldh1l2 T C 10: 83,522,846 Y95C probably damaging Het
Asxl2 A G 12: 3,501,425 T1056A probably damaging Het
B4galnt1 A G 10: 127,169,779 T250A possibly damaging Het
Cela3b A T 4: 137,423,843 probably null Het
Chst3 T C 10: 60,185,832 T398A probably damaging Het
Cngb3 A G 4: 19,425,625 T478A probably damaging Het
Cyp4a10 T C 4: 115,518,455 L45P probably damaging Het
D630003M21Rik A G 2: 158,217,648 S111P probably benign Het
Defb21 A G 2: 152,574,751 E49G possibly damaging Het
Dnajc1 T C 2: 18,308,834 T159A probably damaging Het
Dnmbp A G 19: 43,902,354 S325P probably benign Het
Fam91a1 T C 15: 58,442,871 F534L probably damaging Het
Fermt2 T C 14: 45,464,863 E488G probably damaging Het
Filip1 T C 9: 79,819,180 D719G possibly damaging Het
Gad1-ps A G 10: 99,445,151 noncoding transcript Het
Glra3 C A 8: 55,940,962 A36E probably benign Het
Hnrnpm C T 17: 33,669,168 probably null Het
Lct T A 1: 128,308,047 R408* probably null Het
Lrrk2 T A 15: 91,767,339 Y1733N probably damaging Het
Mindy1 T C 3: 95,288,390 L148P probably damaging Het
Mkrn2 C A 6: 115,611,789 Y164* probably null Het
Msra T C 14: 64,210,435 Y135C probably damaging Het
Ndst3 C T 3: 123,548,916 A749T probably damaging Het
Ngdn G T 14: 55,017,114 A41S probably benign Het
Nlrp12 A T 7: 3,240,092 S597T probably damaging Het
Olfr1451 A T 19: 12,999,417 I144F probably damaging Het
Pabpc6 A G 17: 9,667,970 S551P probably benign Het
Plekhg5 C T 4: 152,112,553 A752V probably benign Het
Prpf4b T C 13: 34,884,291 S368P probably benign Het
Pus7 A G 5: 23,746,424 probably null Het
Rab40b C G 11: 121,357,962 V156L probably benign Het
Slc9a9 T A 9: 95,055,459 S455T probably benign Het
Tmem26 A T 10: 68,778,606 N284Y probably damaging Het
Tmem87a T C 2: 120,380,769 I232V probably benign Het
Trpm2 A G 10: 77,923,984 L1106P probably damaging Het
Tshz1 A G 18: 84,014,661 Y541H probably damaging Het
Zfp365 A G 10: 67,909,354 V198A probably damaging Het
Zfp618 G A 4: 63,132,826 V615M probably damaging Het
Other mutations in Zfp213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Zfp213 APN 17 23561417 missense probably benign 0.18
IGL02302:Zfp213 APN 17 23557971 missense possibly damaging 0.88
R2137:Zfp213 UTSW 17 23559507 synonymous probably null
R4010:Zfp213 UTSW 17 23558090 missense possibly damaging 0.93
R5149:Zfp213 UTSW 17 23561399 missense probably damaging 0.97
R5595:Zfp213 UTSW 17 23561186 missense possibly damaging 0.92
R5979:Zfp213 UTSW 17 23557911 nonsense probably null
R6227:Zfp213 UTSW 17 23558022 missense probably benign 0.16
R6711:Zfp213 UTSW 17 23559511 missense probably benign
R7105:Zfp213 UTSW 17 23558204 missense probably benign 0.40
R7409:Zfp213 UTSW 17 23559629 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGTCTTCCACCAAAGCGACAGC -3'
(R):5'- AAGTGTGTCCTGATGCCAACCC -3'

Sequencing Primer
(F):5'- CCAAGGTGCTGTCTCTGAAG -3'
(R):5'- ACTGAAAGGCTCAGCTCTG -3'
Posted On2015-02-04