Incidental Mutation 'ANU22:Caln1'
ID262579
Institutional Source Beutler Lab
Gene Symbol Caln1
Ensembl Gene ENSMUSG00000060371
Gene Namecalneuron 1
Synonyms9630012C17Rik, Cabp8
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #ANU22
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location130369455-130847412 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130669551 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 96 (E96G)
Ref Sequence ENSEMBL: ENSMUSP00000106919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086029] [ENSMUST00000111287] [ENSMUST00000111288]
Predicted Effect probably damaging
Transcript: ENSMUST00000086029
AA Change: E138G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083193
Gene: ENSMUSG00000060371
AA Change: E138G

DomainStartEndE-ValueType
EFh 82 110 2.98e-9 SMART
EFh 118 146 2.06e-3 SMART
low complexity region 195 204 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111287
AA Change: E96G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106918
Gene: ENSMUSG00000060371
AA Change: E96G

DomainStartEndE-ValueType
EFh 40 68 2.98e-9 SMART
EFh 76 104 2.06e-3 SMART
low complexity region 153 162 N/A INTRINSIC
transmembrane domain 192 214 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111288
AA Change: E96G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106919
Gene: ENSMUSG00000060371
AA Change: E96G

DomainStartEndE-ValueType
EFh 40 68 2.98e-9 SMART
EFh 76 104 2.06e-3 SMART
low complexity region 153 162 N/A INTRINSIC
transmembrane domain 192 214 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.1%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with high similarity to the calcium-binding proteins of the calmodulin family. The encoded protein contains two EF-hand domains and potential calcium-binding sites. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 A G 15: 81,913,714 E663G possibly damaging Het
Adam29 T A 8: 55,871,844 H525L probably benign Het
Adamts2 A G 11: 50,737,363 N297D probably benign Het
Adamts6 T A 13: 104,390,082 V506E probably damaging Het
Ankfy1 G A 11: 72,764,791 E1101K probably damaging Het
Arap3 C T 18: 37,991,327 probably null Het
Asxl3 T A 18: 22,516,446 H497Q probably benign Het
Cdh23 T C 10: 60,312,624 T2653A probably damaging Het
Cdk5rap2 T A 4: 70,380,235 I87F possibly damaging Het
Crybg3 T A 16: 59,529,227 H934L probably damaging Het
Cyp2d22 G A 15: 82,371,668 T461I probably damaging Het
Dhcr24 T C 4: 106,572,278 F183L possibly damaging Het
Dusp16 A T 6: 134,718,861 S336T probably benign Het
F930017D23Rik T G 10: 43,604,375 noncoding transcript Het
Fasl A G 1: 161,781,838 V193A probably damaging Het
Fgf5 T C 5: 98,275,316 Y187H probably damaging Het
Focad C A 4: 88,393,547 Q1423K probably benign Het
Gabrp T C 11: 33,555,055 T249A probably damaging Het
Galnt5 A T 2: 58,025,342 K637* probably null Het
Grm6 A T 11: 50,859,519 D503V probably benign Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Lyst C T 13: 13,678,056 R2214C probably benign Het
Micu2 T A 14: 57,943,625 D184V probably damaging Het
Nabp2 T A 10: 128,408,762 I52F probably damaging Het
Nat8f7 A T 6: 85,707,588 L90* probably null Het
Olfr1297 T C 2: 111,621,201 N291S probably damaging Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Pphln1 A G 15: 93,489,104 E273G probably damaging Het
Ppil1 C A 17: 29,263,888 V14F possibly damaging Het
Ptprd C A 4: 76,100,456 D694Y probably damaging Het
Relt A T 7: 100,851,698 L28Q probably damaging Het
Sptbn4 G A 7: 27,357,387 R2525* probably null Het
St8sia5 G A 18: 77,254,662 G320D probably damaging Het
Taf2 T C 15: 55,048,274 E582G probably damaging Het
Tas2r116 T A 6: 132,855,443 N2K probably benign Het
Tedc1 C T 12: 113,163,188 R357* probably null Het
Tmem168 A T 6: 13,583,046 V612E probably damaging Het
Unc79 A G 12: 103,001,871 S119G probably damaging Het
Washc5 T A 15: 59,355,839 K425* probably null Het
Wdr61 C A 9: 54,728,186 V44L probably damaging Het
Wtap G T 17: 12,967,895 T255K probably benign Het
Zfp148 T C 16: 33,456,943 V134A probably benign Het
Zfp397 C T 18: 23,960,751 S431L probably damaging Het
Other mutations in Caln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Caln1 APN 5 130669551 missense probably damaging 1.00
IGL03152:Caln1 APN 5 130617852 missense probably damaging 0.97
IGL03409:Caln1 APN 5 130617878 missense probably damaging 1.00
R0346:Caln1 UTSW 5 130822921 missense possibly damaging 0.83
R2180:Caln1 UTSW 5 130839408 makesense probably null
R2352:Caln1 UTSW 5 130506152 nonsense probably null
R5489:Caln1 UTSW 5 130414832 missense possibly damaging 0.66
R7114:Caln1 UTSW 5 130839283 missense possibly damaging 0.93
R7159:Caln1 UTSW 5 130822997 missense probably benign 0.20
R7355:Caln1 UTSW 5 130414891 missense probably benign
R7611:Caln1 UTSW 5 130506077 missense probably damaging 0.99
R8119:Caln1 UTSW 5 130822984 missense probably damaging 0.96
Z1177:Caln1 UTSW 5 130839314 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGCAGCAAACATATCCAGGACAAATT -3'
(R):5'- GACACCCAAGGCTTCACAGTGAAA -3'

Sequencing Primer
(F):5'- aaacaaacaaacaaacaacaacaac -3'
(R):5'- CACAGTGAAAGTTAGTTGATCCCAG -3'
Posted On2015-02-04