Mutagenetix > Incidental Mutation

Incidental Mutation 'ANU22:Sptbn4'

262584

Institutional Source

Beutler Lab

Gene Symbol

Sptbn4

Ensembl Gene

ENSMUSG00000011751

Gene Name

spectrin beta, non-erythrocytic 4

Synonyms

nmf261, 1700022P15Rik, SpbIV, ROSA62, 5830426A08Rik, dyn, neuroaxonal dystrophy, Spnb4

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.391) question?

Stock #

ANU22

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27055808-27147111 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 27056812 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 2525 (R2525*)

Ref Sequence

ENSEMBL: ENSMUSP00000132807 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003857] [ENSMUST00000011895] [ENSMUST00000108362] [ENSMUST00000108363] [ENSMUST00000108364] [ENSMUST00000172269]

AlphaFold

E9PX29

Predicted Effect

probably benign
Transcript: ENSMUST00000003857

SMART Domains

Protein: ENSMUSP00000003857
Gene: ENSMUSG00000089832

Domain	Start	End	E-Value	Type
BTB	19	119	1.65e-16	SMART
low complexity region	183	194	N/A	INTRINSIC
Blast:WD40	196	271	1e-21	BLAST
WD40	277	313	1.9e2	SMART
WD40	419	457	3.45e-1	SMART
WD40	527	577	3.68e1	SMART
low complexity region	612	631	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000011895
AA Change: R2531*

SMART Domains

Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: R2531*

Domain	Start	End	E-Value	Type
low complexity region	39	45	N/A	INTRINSIC
CH	64	164	8.03e-24	SMART
CH	183	281	7.38e-23	SMART
Pfam:Spectrin	310	420	1.4e-10	PFAM
SPEC	433	533	5.22e-26	SMART
SPEC	539	642	7.62e-19	SMART
SPEC	648	766	1.31e-8	SMART
SPEC	772	874	2.94e-11	SMART
SPEC	880	980	1.49e-21	SMART
SPEC	986	1081	1.65e0	SMART
SPEC	1087	1192	2.82e-13	SMART
SPEC	1198	1298	6.59e-14	SMART
SPEC	1304	1403	4.08e-19	SMART
SPEC	1409	1508	5.92e-7	SMART
SPEC	1514	1614	2.45e-22	SMART
SPEC	1620	1720	1.45e-24	SMART
SPEC	1726	1827	1.86e-22	SMART
SPEC	1833	1935	9.54e-11	SMART
SPEC	1941	2041	1.35e-19	SMART
SPEC	2047	2297	1.06e-8	SMART
low complexity region	2358	2412	N/A	INTRINSIC
PH	2416	2526	1.54e-14	SMART
low complexity region	2549	2560	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108362
AA Change: R1211*

SMART Domains

Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751
AA Change: R1211*

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108363
AA Change: R1211*

SMART Domains

Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751
AA Change: R1211*

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108364
AA Change: R1211*

SMART Domains

Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751
AA Change: R1211*

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123190

Predicted Effect

probably null
Transcript: ENSMUST00000126587
AA Change: R11*

Predicted Effect

probably null
Transcript: ENSMUST00000172269
AA Change: R2525*

SMART Domains

Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: R2525*

Domain	Start	End	E-Value	Type
low complexity region	39	45	N/A	INTRINSIC
CH	64	164	8.03e-24	SMART
CH	183	281	7.38e-23	SMART
Pfam:Spectrin	310	420	1.9e-10	PFAM
SPEC	433	533	5.22e-26	SMART
SPEC	539	637	3.45e-17	SMART
SPEC	643	761	1.31e-8	SMART
SPEC	767	869	2.94e-11	SMART
SPEC	875	975	1.49e-21	SMART
SPEC	981	1076	1.65e0	SMART
SPEC	1082	1187	2.82e-13	SMART
SPEC	1193	1293	6.59e-14	SMART
SPEC	1299	1398	4.08e-19	SMART
SPEC	1404	1503	5.92e-7	SMART
SPEC	1509	1609	2.45e-22	SMART
SPEC	1615	1715	1.45e-24	SMART
SPEC	1721	1822	1.86e-22	SMART
SPEC	1828	1930	9.54e-11	SMART
SPEC	1936	2036	1.35e-19	SMART
SPEC	2042	2292	1.06e-8	SMART
low complexity region	2352	2406	N/A	INTRINSIC
PH	2410	2520	1.54e-14	SMART
low complexity region	2543	2554	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136589

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138449

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132684

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157078

Coding Region Coverage

1x: 98.7%
3x: 98.1%
10x: 96.2%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aco2	A	G	15: 81,797,915 (GRCm39)	E663G	possibly damaging	Het
Adam29	T	A	8: 56,324,879 (GRCm39)	H525L	probably benign	Het
Adamts2	A	G	11: 50,628,190 (GRCm39)	N297D	probably benign	Het
Adamts6	T	A	13: 104,526,590 (GRCm39)	V506E	probably damaging	Het
Ankfy1	G	A	11: 72,655,617 (GRCm39)	E1101K	probably damaging	Het
Arap3	C	T	18: 38,124,380 (GRCm39)		probably null	Het
Asxl3	T	A	18: 22,649,503 (GRCm39)	H497Q	probably benign	Het
Caln1	A	G	5: 130,698,392 (GRCm39)	E96G	probably damaging	Het
Cdh23	T	C	10: 60,148,403 (GRCm39)	T2653A	probably damaging	Het
Cdk5rap2	T	A	4: 70,298,472 (GRCm39)	I87F	possibly damaging	Het
Crybg3	T	A	16: 59,349,590 (GRCm39)	H934L	probably damaging	Het
Cyp2d22	G	A	15: 82,255,869 (GRCm39)	T461I	probably damaging	Het
Dhcr24	T	C	4: 106,429,475 (GRCm39)	F183L	possibly damaging	Het
Dusp16	A	T	6: 134,695,824 (GRCm39)	S336T	probably benign	Het
F930017D23Rik	T	G	10: 43,480,371 (GRCm39)		noncoding transcript	Het
Fasl	A	G	1: 161,609,407 (GRCm39)	V193A	probably damaging	Het
Fgf5	T	C	5: 98,423,175 (GRCm39)	Y187H	probably damaging	Het
Focad	C	A	4: 88,311,784 (GRCm39)	Q1423K	probably benign	Het
Gabrp	T	C	11: 33,505,055 (GRCm39)	T249A	probably damaging	Het
Galnt5	A	T	2: 57,915,354 (GRCm39)	K637*	probably null	Het
Grm6	A	T	11: 50,750,346 (GRCm39)	D503V	probably benign	Het
Hmg20a	A	T	9: 56,394,934 (GRCm39)	D216V	probably damaging	Het
Lyst	C	T	13: 13,852,641 (GRCm39)	R2214C	probably benign	Het
Micu2	T	A	14: 58,181,082 (GRCm39)	D184V	probably damaging	Het
Nabp2	T	A	10: 128,244,631 (GRCm39)	I52F	probably damaging	Het
Nat8f7	A	T	6: 85,684,570 (GRCm39)	L90*	probably null	Het
Or2z2	A	T	11: 58,346,088 (GRCm39)	M229K	probably damaging	Het
Or4k47	T	C	2: 111,451,546 (GRCm39)	N291S	probably damaging	Het
Pphln1	A	G	15: 93,386,985 (GRCm39)	E273G	probably damaging	Het
Ppil1	C	A	17: 29,482,862 (GRCm39)	V14F	possibly damaging	Het
Ptprd	C	A	4: 76,018,693 (GRCm39)	D694Y	probably damaging	Het
Relt	A	T	7: 100,500,905 (GRCm39)	L28Q	probably damaging	Het
Skic8	C	A	9: 54,635,470 (GRCm39)	V44L	probably damaging	Het
St8sia5	G	A	18: 77,342,358 (GRCm39)	G320D	probably damaging	Het
Taf2	T	C	15: 54,911,670 (GRCm39)	E582G	probably damaging	Het
Tas2r116	T	A	6: 132,832,406 (GRCm39)	N2K	probably benign	Het
Tedc1	C	T	12: 113,126,808 (GRCm39)	R357*	probably null	Het
Tmem168	A	T	6: 13,583,045 (GRCm39)	V612E	probably damaging	Het
Unc79	A	G	12: 102,968,130 (GRCm39)	S119G	probably damaging	Het
Washc5	T	A	15: 59,227,688 (GRCm39)	K425*	probably null	Het
Wtap	G	T	17: 13,186,782 (GRCm39)	T255K	probably benign	Het
Zfp148	T	C	16: 33,277,313 (GRCm39)	V134A	probably benign	Het
Zfp397	C	T	18: 24,093,808 (GRCm39)	S431L	probably damaging	Het

Other mutations in Sptbn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Sptbn4	APN	7	27,068,859 (GRCm39)	missense	probably damaging	1.00
IGL00468:Sptbn4	APN	7	27,117,390 (GRCm39)	missense	probably damaging	1.00
IGL01396:Sptbn4	APN	7	27,114,196 (GRCm39)	missense	probably benign	0.06
IGL01700:Sptbn4	APN	7	27,103,693 (GRCm39)	missense	probably damaging	1.00
IGL01878:Sptbn4	APN	7	27,063,571 (GRCm39)	missense	probably damaging	0.99
IGL02066:Sptbn4	APN	7	27,063,940 (GRCm39)	missense	possibly damaging	0.68
IGL02116:Sptbn4	APN	7	27,063,782 (GRCm39)	missense	probably benign
IGL02226:Sptbn4	APN	7	27,065,132 (GRCm39)	missense	probably damaging	1.00
IGL02333:Sptbn4	APN	7	27,063,724 (GRCm39)	missense	probably damaging	1.00
IGL02337:Sptbn4	APN	7	27,127,672 (GRCm39)	missense	probably benign	0.03
IGL02451:Sptbn4	APN	7	27,065,014 (GRCm39)	missense	probably null	0.15
IGL02487:Sptbn4	APN	7	27,118,522 (GRCm39)	missense	probably damaging	1.00
IGL02530:Sptbn4	APN	7	27,090,976 (GRCm39)	missense	probably damaging	1.00
IGL02724:Sptbn4	APN	7	27,067,104 (GRCm39)	missense	probably damaging	1.00
IGL02850:Sptbn4	APN	7	27,126,258 (GRCm39)	missense	possibly damaging	0.95
IGL02851:Sptbn4	APN	7	27,126,258 (GRCm39)	missense	possibly damaging	0.95
IGL02869:Sptbn4	APN	7	27,093,573 (GRCm39)	splice site	probably benign
IGL02961:Sptbn4	APN	7	27,097,392 (GRCm39)	missense	probably damaging	1.00
R0194:Sptbn4	UTSW	7	27,104,336 (GRCm39)	missense	probably benign	0.00
R0328:Sptbn4	UTSW	7	27,063,595 (GRCm39)	missense	probably damaging	1.00
R0379:Sptbn4	UTSW	7	27,059,161 (GRCm39)	splice site	probably benign
R0510:Sptbn4	UTSW	7	27,060,991 (GRCm39)	critical splice donor site	probably null
R0550:Sptbn4	UTSW	7	27,063,803 (GRCm39)	missense	probably benign	0.16
R0557:Sptbn4	UTSW	7	27,107,753 (GRCm39)	nonsense	probably null
R1336:Sptbn4	UTSW	7	27,117,388 (GRCm39)	missense	probably damaging	1.00
R1494:Sptbn4	UTSW	7	27,133,719 (GRCm39)	missense	probably damaging	1.00
R1630:Sptbn4	UTSW	7	27,118,164 (GRCm39)	missense	probably benign	0.09
R1803:Sptbn4	UTSW	7	27,118,008 (GRCm39)	missense	probably damaging	1.00
R1834:Sptbn4	UTSW	7	27,066,071 (GRCm39)	missense	probably null	0.96
R1906:Sptbn4	UTSW	7	27,090,856 (GRCm39)	critical splice donor site	probably null
R1924:Sptbn4	UTSW	7	27,106,563 (GRCm39)	missense	probably damaging	1.00
R1951:Sptbn4	UTSW	7	27,065,868 (GRCm39)	missense	possibly damaging	0.64
R1989:Sptbn4	UTSW	7	27,067,127 (GRCm39)	missense	probably damaging	1.00
R1990:Sptbn4	UTSW	7	27,123,235 (GRCm39)	missense	probably benign	0.19
R2005:Sptbn4	UTSW	7	27,065,844 (GRCm39)	nonsense	probably null
R2083:Sptbn4	UTSW	7	27,127,681 (GRCm39)	missense	probably benign	0.29
R2176:Sptbn4	UTSW	7	27,063,587 (GRCm39)	missense	probably benign	0.21
R2211:Sptbn4	UTSW	7	27,067,034 (GRCm39)	missense	probably damaging	1.00
R2262:Sptbn4	UTSW	7	27,133,782 (GRCm39)	missense	probably damaging	1.00
R2263:Sptbn4	UTSW	7	27,133,782 (GRCm39)	missense	probably damaging	1.00
R2374:Sptbn4	UTSW	7	27,059,517 (GRCm39)	missense	probably damaging	0.99
R2407:Sptbn4	UTSW	7	27,117,523 (GRCm39)	nonsense	probably null
R4115:Sptbn4	UTSW	7	27,090,995 (GRCm39)	missense	probably damaging	1.00
R4116:Sptbn4	UTSW	7	27,090,995 (GRCm39)	missense	probably damaging	1.00
R4392:Sptbn4	UTSW	7	27,117,896 (GRCm39)	missense	probably damaging	0.97
R4426:Sptbn4	UTSW	7	27,123,223 (GRCm39)	missense	probably damaging	1.00
R4535:Sptbn4	UTSW	7	27,067,127 (GRCm39)	missense	probably damaging	1.00
R4684:Sptbn4	UTSW	7	27,066,160 (GRCm39)	missense	possibly damaging	0.60
R4684:Sptbn4	UTSW	7	27,063,844 (GRCm39)	missense	probably damaging	0.96
R4707:Sptbn4	UTSW	7	27,116,431 (GRCm39)	missense	probably benign	0.12
R4876:Sptbn4	UTSW	7	27,071,577 (GRCm39)	missense	probably damaging	1.00
R5091:Sptbn4	UTSW	7	27,068,816 (GRCm39)	missense	probably damaging	1.00
R5371:Sptbn4	UTSW	7	27,059,166 (GRCm39)	critical splice donor site	probably null
R5790:Sptbn4	UTSW	7	27,065,853 (GRCm39)	missense	probably damaging	0.99
R5857:Sptbn4	UTSW	7	27,118,138 (GRCm39)	missense	possibly damaging	0.89
R5908:Sptbn4	UTSW	7	27,103,678 (GRCm39)	missense	probably benign	0.00
R5980:Sptbn4	UTSW	7	27,071,596 (GRCm39)	missense	probably damaging	1.00
R6005:Sptbn4	UTSW	7	27,118,024 (GRCm39)	missense	probably damaging	1.00
R6013:Sptbn4	UTSW	7	27,063,904 (GRCm39)	missense	probably damaging	0.99
R6037:Sptbn4	UTSW	7	27,063,595 (GRCm39)	missense	probably damaging	0.97
R6037:Sptbn4	UTSW	7	27,063,595 (GRCm39)	missense	probably damaging	0.97
R6129:Sptbn4	UTSW	7	27,059,513 (GRCm39)	missense	probably damaging	0.98
R6146:Sptbn4	UTSW	7	27,064,012 (GRCm39)	nonsense	probably null
R6762:Sptbn4	UTSW	7	27,093,633 (GRCm39)	missense	probably damaging	1.00
R6897:Sptbn4	UTSW	7	27,071,375 (GRCm39)	missense	possibly damaging	0.96
R7178:Sptbn4	UTSW	7	27,117,481 (GRCm39)	missense	probably damaging	1.00
R7212:Sptbn4	UTSW	7	27,116,210 (GRCm39)	missense	probably benign	0.44
R7465:Sptbn4	UTSW	7	27,066,114 (GRCm39)	missense	probably benign	0.00
R7471:Sptbn4	UTSW	7	27,108,439 (GRCm39)	missense	possibly damaging	0.64
R7510:Sptbn4	UTSW	7	27,127,693 (GRCm39)	missense	probably benign	0.13
R7527:Sptbn4	UTSW	7	27,075,015 (GRCm39)	missense	possibly damaging	0.94
R7528:Sptbn4	UTSW	7	27,141,960 (GRCm39)	missense	probably benign	0.00
R7572:Sptbn4	UTSW	7	27,071,697 (GRCm39)	missense	probably damaging	0.99
R7649:Sptbn4	UTSW	7	27,061,002 (GRCm39)	missense	possibly damaging	0.80
R7714:Sptbn4	UTSW	7	27,063,761 (GRCm39)	missense	probably benign	0.02
R7780:Sptbn4	UTSW	7	27,061,059 (GRCm39)	missense	possibly damaging	0.70
R7854:Sptbn4	UTSW	7	27,061,835 (GRCm39)	missense	probably benign
R8002:Sptbn4	UTSW	7	27,117,417 (GRCm39)	missense	possibly damaging	0.91
R8058:Sptbn4	UTSW	7	27,063,694 (GRCm39)	missense	possibly damaging	0.92
R8181:Sptbn4	UTSW	7	27,074,808 (GRCm39)	missense	possibly damaging	0.79
R8195:Sptbn4	UTSW	7	27,108,314 (GRCm39)	nonsense	probably null
R8353:Sptbn4	UTSW	7	27,103,663 (GRCm39)	missense	probably damaging	1.00
R8392:Sptbn4	UTSW	7	27,071,721 (GRCm39)	missense	probably damaging	1.00
R8453:Sptbn4	UTSW	7	27,103,663 (GRCm39)	missense	probably damaging	1.00
R8815:Sptbn4	UTSW	7	27,106,657 (GRCm39)	nonsense	probably null
R8818:Sptbn4	UTSW	7	27,063,592 (GRCm39)	missense	possibly damaging	0.71
R9171:Sptbn4	UTSW	7	27,141,844 (GRCm39)	missense	possibly damaging	0.95
R9259:Sptbn4	UTSW	7	27,067,124 (GRCm39)	missense	possibly damaging	0.74
R9477:Sptbn4	UTSW	7	27,132,624 (GRCm39)	missense	possibly damaging	0.79
R9564:Sptbn4	UTSW	7	27,117,504 (GRCm39)	missense	probably damaging	0.98
R9572:Sptbn4	UTSW	7	27,066,095 (GRCm39)	missense	probably benign	0.16
R9623:Sptbn4	UTSW	7	27,107,807 (GRCm39)	missense	probably damaging	1.00
R9715:Sptbn4	UTSW	7	27,091,000 (GRCm39)	missense	probably damaging	1.00
R9782:Sptbn4	UTSW	7	27,107,993 (GRCm39)	missense	probably benign	0.02
R9790:Sptbn4	UTSW	7	27,071,662 (GRCm39)	missense	probably damaging	0.99
R9791:Sptbn4	UTSW	7	27,071,662 (GRCm39)	missense	probably damaging	0.99
R9798:Sptbn4	UTSW	7	27,056,717 (GRCm39)	makesense	probably null
X0020:Sptbn4	UTSW	7	27,102,159 (GRCm39)	critical splice donor site	probably null
X0066:Sptbn4	UTSW	7	27,056,736 (GRCm39)	unclassified	probably benign
Z1176:Sptbn4	UTSW	7	27,059,450 (GRCm39)	missense	probably damaging	0.99
Z1177:Sptbn4	UTSW	7	27,108,527 (GRCm39)	missense	probably benign	0.41
Z1177:Sptbn4	UTSW	7	27,104,007 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGGCACATCCGCAGTCATTC -3'
(R):5'- AGGCTCCAGCATACCTTTGTTTACC -3'

Sequencing Primer
(F):5'- CCCTTGCGGATGAGAAGTTG -3'
(R):5'- TATGGACTTGTCCTGCGTCT -3'

Posted On

2015-02-04