Incidental Mutation 'R0294:Sphkap'
ID26259
Institutional Source Beutler Lab
Gene Symbol Sphkap
Ensembl Gene ENSMUSG00000026163
Gene NameSPHK1 interactor, AKAP domain containing
Synonyms4930544G21Rik, A930009L15Rik, SKIP
MMRRC Submission 038511-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R0294 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location83254139-83408200 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83278245 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 594 (E594D)
Ref Sequence ENSEMBL: ENSMUSP00000124872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159078] [ENSMUST00000160953]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053075
Predicted Effect probably benign
Transcript: ENSMUST00000159078
AA Change: E307D

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124384
Gene: ENSMUSG00000026163
AA Change: E307D

DomainStartEndE-ValueType
low complexity region 303 314 N/A INTRINSIC
SCOP:d1ash__ 382 462 5e-3 SMART
low complexity region 809 819 N/A INTRINSIC
low complexity region 854 865 N/A INTRINSIC
low complexity region 1202 1221 N/A INTRINSIC
low complexity region 1243 1254 N/A INTRINSIC
Pfam:AKAP_110 1281 1398 7.5e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160953
AA Change: E594D

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124872
Gene: ENSMUSG00000026163
AA Change: E594D

DomainStartEndE-ValueType
low complexity region 590 601 N/A INTRINSIC
SCOP:d1ash__ 669 749 6e-3 SMART
low complexity region 1096 1106 N/A INTRINSIC
low complexity region 1141 1152 N/A INTRINSIC
low complexity region 1489 1508 N/A INTRINSIC
Pfam:AKAP_110 1540 1655 6.4e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Aadat A G 8: 60,534,608 E319G possibly damaging Het
Abca13 A G 11: 9,269,122 probably null Het
Actl7b A T 4: 56,740,848 L170Q possibly damaging Het
Adam29 C A 8: 55,873,276 V48L probably benign Het
Aknad1 A G 3: 108,775,192 Y528C probably damaging Het
Alas1 T A 9: 106,241,256 K222N probably damaging Het
Aplf A G 6: 87,646,245 V284A probably benign Het
Atp11a G A 8: 12,827,524 V317M probably benign Het
Bub3 A G 7: 131,568,224 E206G possibly damaging Het
Cblb T G 16: 52,135,824 F263L probably damaging Het
Ces2h T A 8: 105,016,604 M157K probably benign Het
Cfh A G 1: 140,183,261 F6L probably benign Het
Chst1 G T 2: 92,613,642 R153L probably damaging Het
Cntnap5a T A 1: 115,915,316 N121K probably benign Het
Crybg1 A T 10: 43,986,376 S1467R probably damaging Het
Cyp2d22 A G 15: 82,374,445 F72L possibly damaging Het
Dmrt2 C T 19: 25,678,071 P345S probably damaging Het
Dock8 T C 19: 25,188,350 I1866T probably damaging Het
Egfem1 A G 3: 29,690,121 N503S probably damaging Het
Ehbp1 T C 11: 22,095,427 D774G probably benign Het
Foxp2 C A 6: 15,376,774 probably benign Het
Gins3 T C 8: 95,637,919 V99A possibly damaging Het
Gm597 T C 1: 28,778,663 Q96R probably benign Het
Grm1 A T 10: 11,080,399 I47N probably damaging Het
H2afj C G 6: 136,808,604 R89G probably damaging Het
Hsdl2 T A 4: 59,601,408 S127T probably benign Het
Il5ra A T 6: 106,712,401 M410K probably benign Het
Ints7 A G 1: 191,611,891 S548G possibly damaging Het
Kcnt1 A G 2: 25,888,110 E80G probably damaging Het
Lexm T C 4: 106,613,164 D232G probably damaging Het
Lgr6 A G 1: 134,987,891 V373A probably damaging Het
Lgr6 T A 1: 135,105,061 Q27L unknown Het
Map3k14 T C 11: 103,227,137 I610V possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Metap1d T A 2: 71,522,545 H239Q probably benign Het
Mgst2 A G 3: 51,681,830 Y88C probably damaging Het
Mroh4 T C 15: 74,606,149 N903D probably benign Het
Nbeal2 T G 9: 110,632,859 D1476A probably damaging Het
Nlgn1 C A 3: 26,133,476 A87S probably benign Het
Nln C T 13: 104,052,579 G295S probably damaging Het
Nnt T A 13: 119,336,267 Y719F probably benign Het
Nnt T G 13: 119,338,417 I659L possibly damaging Het
Olfr1006 A G 2: 85,674,716 V145A probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr506 A T 7: 108,613,150 Y281F probably damaging Het
Olfr605 G A 7: 103,443,084 T13I possibly damaging Het
Olfr64 A T 7: 103,892,930 H268Q probably benign Het
Otogl C T 10: 107,777,228 C2041Y probably damaging Het
Patj G T 4: 98,497,048 D300Y probably damaging Het
Pkhd1l1 A T 15: 44,560,435 E3124D probably benign Het
Plbd2 A G 5: 120,487,449 probably null Het
Pphln1 T C 15: 93,420,290 Y57H probably damaging Het
Ppp1r16b C T 2: 158,746,603 T78M probably damaging Het
Prss40 T G 1: 34,556,081 D224A possibly damaging Het
Senp6 A G 9: 80,113,725 probably null Het
Shank3 A G 15: 89,532,098 E666G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc22a18 G A 7: 143,492,841 probably null Het
Slc5a4b A G 10: 76,081,327 C292R probably damaging Het
Srpr T A 9: 35,215,515 M61K probably damaging Het
Trmt10c A T 16: 56,034,877 Y132N possibly damaging Het
Other mutations in Sphkap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Sphkap APN 1 83280516 missense probably damaging 1.00
IGL00337:Sphkap APN 1 83339608 missense probably damaging 1.00
IGL00470:Sphkap APN 1 83277910 missense possibly damaging 0.87
IGL00577:Sphkap APN 1 83278844 missense probably damaging 1.00
IGL00657:Sphkap APN 1 83276375 missense probably damaging 1.00
IGL01868:Sphkap APN 1 83280399 unclassified probably null
IGL02101:Sphkap APN 1 83290987 missense probably damaging 1.00
IGL02471:Sphkap APN 1 83276176 missense probably damaging 1.00
IGL02943:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL02945:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03008:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03031:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03059:Sphkap APN 1 83257242 missense probably damaging 0.97
IGL03085:Sphkap APN 1 83280354 missense possibly damaging 0.92
IGL03355:Sphkap APN 1 83280503 missense probably damaging 1.00
IGL03356:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03368:Sphkap APN 1 83275676 missense probably benign 0.14
R0308:Sphkap UTSW 1 83276969 missense probably damaging 1.00
R0478:Sphkap UTSW 1 83278711 missense probably damaging 1.00
R0606:Sphkap UTSW 1 83280424 missense probably damaging 1.00
R0678:Sphkap UTSW 1 83278628 missense probably benign 0.03
R1216:Sphkap UTSW 1 83290977 missense probably damaging 1.00
R1253:Sphkap UTSW 1 83278898 missense possibly damaging 0.56
R1532:Sphkap UTSW 1 83257203 missense probably damaging 1.00
R1635:Sphkap UTSW 1 83278400 missense probably benign 0.03
R1655:Sphkap UTSW 1 83277515 nonsense probably null
R1657:Sphkap UTSW 1 83277515 nonsense probably null
R1700:Sphkap UTSW 1 83277515 nonsense probably null
R1701:Sphkap UTSW 1 83277515 nonsense probably null
R1734:Sphkap UTSW 1 83277515 nonsense probably null
R1736:Sphkap UTSW 1 83277515 nonsense probably null
R1743:Sphkap UTSW 1 83277515 nonsense probably null
R1744:Sphkap UTSW 1 83277515 nonsense probably null
R1760:Sphkap UTSW 1 83277544 missense probably benign 0.29
R1893:Sphkap UTSW 1 83278966 missense probably benign 0.02
R1937:Sphkap UTSW 1 83267441 nonsense probably null
R1986:Sphkap UTSW 1 83277922 missense probably damaging 1.00
R1993:Sphkap UTSW 1 83277515 nonsense probably null
R1995:Sphkap UTSW 1 83277515 nonsense probably null
R2001:Sphkap UTSW 1 83276662 missense probably damaging 1.00
R2004:Sphkap UTSW 1 83277911 missense probably benign 0.04
R2111:Sphkap UTSW 1 83275881 missense probably benign 0.00
R2112:Sphkap UTSW 1 83275881 missense probably benign 0.00
R2156:Sphkap UTSW 1 83277989 missense probably benign 0.03
R2182:Sphkap UTSW 1 83276684 missense probably damaging 1.00
R2271:Sphkap UTSW 1 83257221 missense probably damaging 1.00
R3712:Sphkap UTSW 1 83277112 missense probably benign 0.27
R3919:Sphkap UTSW 1 83276458 missense probably damaging 1.00
R3980:Sphkap UTSW 1 83267494 splice site probably null
R4130:Sphkap UTSW 1 83277898 missense probably damaging 0.96
R4539:Sphkap UTSW 1 83277793 missense probably benign 0.00
R4602:Sphkap UTSW 1 83279061 nonsense probably null
R4735:Sphkap UTSW 1 83279117 missense probably benign 0.01
R4793:Sphkap UTSW 1 83278084 missense possibly damaging 0.77
R4849:Sphkap UTSW 1 83277384 missense probably benign 0.03
R4880:Sphkap UTSW 1 83288817 missense probably damaging 1.00
R5213:Sphkap UTSW 1 83280503 missense probably damaging 1.00
R5277:Sphkap UTSW 1 83276164 missense probably benign 0.04
R5331:Sphkap UTSW 1 83276782 missense probably benign 0.08
R5632:Sphkap UTSW 1 83278285 missense probably benign 0.01
R5647:Sphkap UTSW 1 83407999 missense probably damaging 0.98
R5751:Sphkap UTSW 1 83275897 missense probably benign 0.27
R5935:Sphkap UTSW 1 83339599 missense probably damaging 1.00
R5999:Sphkap UTSW 1 83267405 missense probably benign 0.02
R6232:Sphkap UTSW 1 83280479 missense probably damaging 1.00
R6318:Sphkap UTSW 1 83278378 missense probably damaging 1.00
R6474:Sphkap UTSW 1 83278823 missense probably damaging 1.00
R6602:Sphkap UTSW 1 83275758 missense possibly damaging 0.75
R6674:Sphkap UTSW 1 83277834 missense probably benign 0.37
R6716:Sphkap UTSW 1 83362228 critical splice donor site probably null
R6803:Sphkap UTSW 1 83280510 missense probably damaging 1.00
R6880:Sphkap UTSW 1 83257257 missense probably damaging 1.00
R6941:Sphkap UTSW 1 83408090 start gained probably benign
R7170:Sphkap UTSW 1 83265985 missense probably damaging 0.99
R7263:Sphkap UTSW 1 83276678 missense probably damaging 1.00
R7422:Sphkap UTSW 1 83263826 missense probably benign 0.02
R7640:Sphkap UTSW 1 83278928 missense possibly damaging 0.94
R7722:Sphkap UTSW 1 83278921 missense probably benign 0.00
R7810:Sphkap UTSW 1 83276300 missense probably damaging 1.00
Z1088:Sphkap UTSW 1 83276608 missense probably damaging 1.00
Z1088:Sphkap UTSW 1 83278604 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCCACAGGGATGCCTTTCATCAG -3'
(R):5'- CCCAAGCATTCATGGCACCTTCTAC -3'

Sequencing Primer
(F):5'- TGAAGTTCATCCACGGAGTGC -3'
(R):5'- TGGCACCTTCTACAACCGAG -3'
Posted On2013-04-16