Incidental Mutation 'ANU22:Cdh23'
ID 262591
Institutional Source Beutler Lab
Gene Symbol Cdh23
Ensembl Gene ENSMUSG00000012819
Gene Name cadherin related 23 (otocadherin)
Synonyms bob, sals, USH1D, ahl, mdfw, nmf252, 4930542A03Rik, nmf112, nmf181
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.388) question?
Stock # ANU22
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 60138527-60532269 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 60148403 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 2653 (T2653A)
Ref Sequence ENSEMBL: ENSMUSP00000101104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000073242
AA Change: T2654A

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819
AA Change: T2654A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 8.11e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1415 1.21e-18 SMART
CA 1440 1524 2.38e-26 SMART
CA 1549 1631 6.27e-26 SMART
CA 1656 1741 6.99e-24 SMART
CA 1765 1848 3.49e-24 SMART
CA 1872 1956 2.78e-18 SMART
CA 1984 2066 5.6e-14 SMART
CA 2090 2171 2.59e-27 SMART
CA 2195 2290 2.87e-11 SMART
CA 2317 2399 1.01e-20 SMART
CA 2423 2506 1.09e-25 SMART
CA 2530 2608 7.91e-23 SMART
CA 2634 2719 1.06e-23 SMART
CA 2750 2843 2e-10 SMART
Blast:CA 2867 2956 4e-51 BLAST
transmembrane domain 3067 3089 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105461
AA Change: T2655A

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819
AA Change: T2655A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105462
AA Change: T2657A

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819
AA Change: T2657A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 261 349 2.03e-11 SMART
CA 374 461 8.11e-11 SMART
CA 485 562 1.04e-22 SMART
CA 586 672 3.55e-25 SMART
CA 696 779 2.04e-25 SMART
CA 803 891 5.03e-16 SMART
CA 915 996 1.05e-27 SMART
CA 1020 1103 1.99e-19 SMART
CA 1127 1209 6.94e-19 SMART
CA 1234 1314 1.99e-19 SMART
CA 1338 1418 1.21e-18 SMART
CA 1443 1527 2.38e-26 SMART
CA 1552 1634 6.27e-26 SMART
CA 1659 1744 6.99e-24 SMART
CA 1768 1851 3.49e-24 SMART
CA 1875 1959 2.78e-18 SMART
CA 1987 2069 5.6e-14 SMART
CA 2093 2174 2.59e-27 SMART
CA 2198 2293 2.87e-11 SMART
CA 2320 2402 1.01e-20 SMART
CA 2426 2509 1.09e-25 SMART
CA 2533 2611 7.91e-23 SMART
CA 2637 2722 1.06e-23 SMART
CA 2753 2846 2e-10 SMART
Blast:CA 2870 2959 4e-51 BLAST
transmembrane domain 3070 3092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105463
AA Change: T2655A

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819
AA Change: T2655A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105464
AA Change: T2653A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819
AA Change: T2653A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 456 3.58e-12 SMART
CA 480 557 1.04e-22 SMART
CA 581 667 3.55e-25 SMART
CA 691 774 2.04e-25 SMART
CA 798 886 5.03e-16 SMART
CA 910 991 1.05e-27 SMART
CA 1015 1098 1.99e-19 SMART
CA 1122 1204 6.94e-19 SMART
CA 1229 1309 1.99e-19 SMART
CA 1333 1414 5.26e-19 SMART
CA 1439 1523 2.38e-26 SMART
CA 1548 1630 6.27e-26 SMART
CA 1655 1740 6.99e-24 SMART
CA 1764 1847 3.49e-24 SMART
CA 1871 1955 2.78e-18 SMART
CA 1983 2065 5.6e-14 SMART
CA 2089 2170 2.59e-27 SMART
CA 2194 2289 2.87e-11 SMART
CA 2316 2398 1.01e-20 SMART
CA 2422 2505 1.09e-25 SMART
CA 2529 2607 7.91e-23 SMART
CA 2633 2718 1.06e-23 SMART
CA 2749 2842 2e-10 SMART
Blast:CA 2866 2955 3e-51 BLAST
transmembrane domain 3066 3088 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153525
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.1%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 A G 15: 81,797,915 (GRCm39) E663G possibly damaging Het
Adam29 T A 8: 56,324,879 (GRCm39) H525L probably benign Het
Adamts2 A G 11: 50,628,190 (GRCm39) N297D probably benign Het
Adamts6 T A 13: 104,526,590 (GRCm39) V506E probably damaging Het
Ankfy1 G A 11: 72,655,617 (GRCm39) E1101K probably damaging Het
Arap3 C T 18: 38,124,380 (GRCm39) probably null Het
Asxl3 T A 18: 22,649,503 (GRCm39) H497Q probably benign Het
Caln1 A G 5: 130,698,392 (GRCm39) E96G probably damaging Het
Cdk5rap2 T A 4: 70,298,472 (GRCm39) I87F possibly damaging Het
Crybg3 T A 16: 59,349,590 (GRCm39) H934L probably damaging Het
Cyp2d22 G A 15: 82,255,869 (GRCm39) T461I probably damaging Het
Dhcr24 T C 4: 106,429,475 (GRCm39) F183L possibly damaging Het
Dusp16 A T 6: 134,695,824 (GRCm39) S336T probably benign Het
F930017D23Rik T G 10: 43,480,371 (GRCm39) noncoding transcript Het
Fasl A G 1: 161,609,407 (GRCm39) V193A probably damaging Het
Fgf5 T C 5: 98,423,175 (GRCm39) Y187H probably damaging Het
Focad C A 4: 88,311,784 (GRCm39) Q1423K probably benign Het
Gabrp T C 11: 33,505,055 (GRCm39) T249A probably damaging Het
Galnt5 A T 2: 57,915,354 (GRCm39) K637* probably null Het
Grm6 A T 11: 50,750,346 (GRCm39) D503V probably benign Het
Hmg20a A T 9: 56,394,934 (GRCm39) D216V probably damaging Het
Lyst C T 13: 13,852,641 (GRCm39) R2214C probably benign Het
Micu2 T A 14: 58,181,082 (GRCm39) D184V probably damaging Het
Nabp2 T A 10: 128,244,631 (GRCm39) I52F probably damaging Het
Nat8f7 A T 6: 85,684,570 (GRCm39) L90* probably null Het
Or2z2 A T 11: 58,346,088 (GRCm39) M229K probably damaging Het
Or4k47 T C 2: 111,451,546 (GRCm39) N291S probably damaging Het
Pphln1 A G 15: 93,386,985 (GRCm39) E273G probably damaging Het
Ppil1 C A 17: 29,482,862 (GRCm39) V14F possibly damaging Het
Ptprd C A 4: 76,018,693 (GRCm39) D694Y probably damaging Het
Relt A T 7: 100,500,905 (GRCm39) L28Q probably damaging Het
Skic8 C A 9: 54,635,470 (GRCm39) V44L probably damaging Het
Sptbn4 G A 7: 27,056,812 (GRCm39) R2525* probably null Het
St8sia5 G A 18: 77,342,358 (GRCm39) G320D probably damaging Het
Taf2 T C 15: 54,911,670 (GRCm39) E582G probably damaging Het
Tas2r116 T A 6: 132,832,406 (GRCm39) N2K probably benign Het
Tedc1 C T 12: 113,126,808 (GRCm39) R357* probably null Het
Tmem168 A T 6: 13,583,045 (GRCm39) V612E probably damaging Het
Unc79 A G 12: 102,968,130 (GRCm39) S119G probably damaging Het
Washc5 T A 15: 59,227,688 (GRCm39) K425* probably null Het
Wtap G T 17: 13,186,782 (GRCm39) T255K probably benign Het
Zfp148 T C 16: 33,277,313 (GRCm39) V134A probably benign Het
Zfp397 C T 18: 24,093,808 (GRCm39) S431L probably damaging Het
Other mutations in Cdh23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Cdh23 APN 10 60,359,327 (GRCm39) missense probably benign 0.03
IGL00429:Cdh23 APN 10 60,256,920 (GRCm39) missense probably damaging 0.97
IGL01014:Cdh23 APN 10 60,143,301 (GRCm39) missense probably damaging 0.99
IGL01284:Cdh23 APN 10 60,301,876 (GRCm39) missense possibly damaging 0.95
IGL01305:Cdh23 APN 10 60,148,403 (GRCm39) missense probably damaging 1.00
IGL01367:Cdh23 APN 10 60,146,566 (GRCm39) missense probably damaging 1.00
IGL01396:Cdh23 APN 10 60,220,848 (GRCm39) missense possibly damaging 0.93
IGL01412:Cdh23 APN 10 60,150,473 (GRCm39) missense probably damaging 1.00
IGL01461:Cdh23 APN 10 60,244,926 (GRCm39) missense possibly damaging 0.53
IGL01469:Cdh23 APN 10 60,433,504 (GRCm39) missense probably benign 0.03
IGL01695:Cdh23 APN 10 60,167,612 (GRCm39) missense probably benign 0.20
IGL01734:Cdh23 APN 10 60,139,292 (GRCm39) missense probably benign
IGL01767:Cdh23 APN 10 60,151,503 (GRCm39) missense probably damaging 1.00
IGL01796:Cdh23 APN 10 60,146,916 (GRCm39) missense probably benign 0.31
IGL01843:Cdh23 APN 10 60,255,598 (GRCm39) splice site probably null
IGL02025:Cdh23 APN 10 60,220,922 (GRCm39) missense probably damaging 1.00
IGL02071:Cdh23 APN 10 60,359,339 (GRCm39) missense possibly damaging 0.93
IGL02160:Cdh23 APN 10 60,433,544 (GRCm39) splice site probably benign
IGL02175:Cdh23 APN 10 60,167,087 (GRCm39) missense possibly damaging 0.92
IGL02220:Cdh23 APN 10 60,140,903 (GRCm39) missense probably damaging 1.00
IGL02302:Cdh23 APN 10 60,159,302 (GRCm39) missense possibly damaging 0.87
IGL02331:Cdh23 APN 10 60,301,322 (GRCm39) missense probably damaging 0.99
IGL02452:Cdh23 APN 10 60,153,721 (GRCm39) missense probably damaging 0.99
IGL02499:Cdh23 APN 10 60,220,958 (GRCm39) missense probably damaging 1.00
IGL02548:Cdh23 APN 10 60,485,901 (GRCm39) missense probably benign 0.37
IGL02593:Cdh23 APN 10 60,301,774 (GRCm39) splice site probably benign
IGL02626:Cdh23 APN 10 60,227,580 (GRCm39) missense probably damaging 1.00
IGL02951:Cdh23 APN 10 60,147,143 (GRCm39) missense probably damaging 1.00
IGL03145:Cdh23 APN 10 60,212,593 (GRCm39) missense probably damaging 0.99
dee_dee UTSW 10 60,143,835 (GRCm39) nonsense probably null
hersey UTSW 10 60,143,815 (GRCm39) missense probably damaging 1.00
IGL02980:Cdh23 UTSW 10 60,150,399 (GRCm39) missense probably damaging 1.00
PIT4362001:Cdh23 UTSW 10 60,301,237 (GRCm39) missense probably benign 0.15
R0013:Cdh23 UTSW 10 60,248,952 (GRCm39) missense possibly damaging 0.90
R0045:Cdh23 UTSW 10 60,366,757 (GRCm39) missense probably damaging 1.00
R0045:Cdh23 UTSW 10 60,366,757 (GRCm39) missense probably damaging 1.00
R0082:Cdh23 UTSW 10 60,148,366 (GRCm39) missense probably damaging 1.00
R0124:Cdh23 UTSW 10 60,143,835 (GRCm39) nonsense probably null
R0172:Cdh23 UTSW 10 60,155,411 (GRCm39) missense probably damaging 1.00
R0195:Cdh23 UTSW 10 60,152,838 (GRCm39) missense probably damaging 0.99
R0365:Cdh23 UTSW 10 60,215,094 (GRCm39) missense probably damaging 0.99
R0437:Cdh23 UTSW 10 60,246,576 (GRCm39) missense probably damaging 1.00
R0486:Cdh23 UTSW 10 60,222,725 (GRCm39) missense probably damaging 1.00
R0494:Cdh23 UTSW 10 60,152,375 (GRCm39) splice site probably benign
R0545:Cdh23 UTSW 10 60,167,070 (GRCm39) missense probably benign 0.06
R0619:Cdh23 UTSW 10 60,269,556 (GRCm39) missense probably damaging 1.00
R0647:Cdh23 UTSW 10 60,159,153 (GRCm39) nonsense probably null
R0647:Cdh23 UTSW 10 60,143,681 (GRCm39) missense probably damaging 0.99
R0730:Cdh23 UTSW 10 60,159,493 (GRCm39) missense probably damaging 0.99
R0880:Cdh23 UTSW 10 60,242,200 (GRCm39) missense possibly damaging 0.51
R0942:Cdh23 UTSW 10 60,246,639 (GRCm39) missense possibly damaging 0.67
R0989:Cdh23 UTSW 10 60,370,289 (GRCm39) missense probably damaging 0.99
R1017:Cdh23 UTSW 10 60,167,572 (GRCm39) missense probably damaging 1.00
R1173:Cdh23 UTSW 10 60,148,171 (GRCm39) splice site probably benign
R1449:Cdh23 UTSW 10 60,212,730 (GRCm39) missense probably damaging 1.00
R1456:Cdh23 UTSW 10 60,322,899 (GRCm39) missense possibly damaging 0.84
R1519:Cdh23 UTSW 10 60,215,122 (GRCm39) missense possibly damaging 0.92
R1532:Cdh23 UTSW 10 60,150,110 (GRCm39) missense probably damaging 0.99
R1559:Cdh23 UTSW 10 60,255,478 (GRCm39) splice site probably benign
R1704:Cdh23 UTSW 10 60,150,390 (GRCm39) missense probably damaging 1.00
R1711:Cdh23 UTSW 10 60,359,315 (GRCm39) missense probably benign 0.07
R1760:Cdh23 UTSW 10 60,161,855 (GRCm39) missense probably damaging 1.00
R1782:Cdh23 UTSW 10 60,324,321 (GRCm39) missense probably damaging 1.00
R1791:Cdh23 UTSW 10 60,227,505 (GRCm39) missense possibly damaging 0.89
R1803:Cdh23 UTSW 10 60,167,060 (GRCm39) missense probably damaging 1.00
R1857:Cdh23 UTSW 10 60,159,076 (GRCm39) missense probably damaging 1.00
R1874:Cdh23 UTSW 10 60,272,597 (GRCm39) missense possibly damaging 0.52
R1914:Cdh23 UTSW 10 60,159,349 (GRCm39) missense probably damaging 0.99
R1958:Cdh23 UTSW 10 60,246,652 (GRCm39) missense probably benign 0.02
R1964:Cdh23 UTSW 10 60,221,001 (GRCm39) missense probably benign 0.31
R1966:Cdh23 UTSW 10 60,159,361 (GRCm39) missense probably damaging 1.00
R1981:Cdh23 UTSW 10 60,214,530 (GRCm39) missense probably damaging 1.00
R2010:Cdh23 UTSW 10 60,150,006 (GRCm39) missense probably damaging 0.99
R2036:Cdh23 UTSW 10 60,301,822 (GRCm39) missense possibly damaging 0.52
R2038:Cdh23 UTSW 10 60,148,366 (GRCm39) missense probably damaging 1.00
R2044:Cdh23 UTSW 10 60,432,509 (GRCm39) missense possibly damaging 0.72
R2111:Cdh23 UTSW 10 60,141,362 (GRCm39) missense probably damaging 0.99
R2112:Cdh23 UTSW 10 60,141,362 (GRCm39) missense probably damaging 0.99
R2211:Cdh23 UTSW 10 60,301,783 (GRCm39) missense possibly damaging 0.92
R2261:Cdh23 UTSW 10 60,152,907 (GRCm39) missense probably damaging 1.00
R2262:Cdh23 UTSW 10 60,152,907 (GRCm39) missense probably damaging 1.00
R2306:Cdh23 UTSW 10 60,159,224 (GRCm39) missense probably damaging 1.00
R2344:Cdh23 UTSW 10 60,152,503 (GRCm39) missense probably damaging 1.00
R2857:Cdh23 UTSW 10 60,218,432 (GRCm39) critical splice donor site probably null
R2858:Cdh23 UTSW 10 60,218,432 (GRCm39) critical splice donor site probably null
R2859:Cdh23 UTSW 10 60,218,432 (GRCm39) critical splice donor site probably null
R2876:Cdh23 UTSW 10 60,143,275 (GRCm39) missense probably damaging 1.00
R3034:Cdh23 UTSW 10 60,244,789 (GRCm39) splice site probably benign
R3424:Cdh23 UTSW 10 60,212,660 (GRCm39) missense possibly damaging 0.76
R3699:Cdh23 UTSW 10 60,163,149 (GRCm39) critical splice donor site probably null
R3700:Cdh23 UTSW 10 60,163,149 (GRCm39) critical splice donor site probably null
R3950:Cdh23 UTSW 10 60,493,105 (GRCm39) missense probably benign 0.04
R3951:Cdh23 UTSW 10 60,493,105 (GRCm39) missense probably benign 0.04
R3952:Cdh23 UTSW 10 60,493,105 (GRCm39) missense probably benign 0.04
R4108:Cdh23 UTSW 10 60,246,601 (GRCm39) missense possibly damaging 0.51
R4114:Cdh23 UTSW 10 60,256,819 (GRCm39) splice site probably null
R4273:Cdh23 UTSW 10 60,146,940 (GRCm39) missense possibly damaging 0.69
R4284:Cdh23 UTSW 10 60,139,272 (GRCm39) missense possibly damaging 0.91
R4334:Cdh23 UTSW 10 60,220,838 (GRCm39) missense probably damaging 0.99
R4474:Cdh23 UTSW 10 60,146,865 (GRCm39) missense probably damaging 1.00
R4532:Cdh23 UTSW 10 60,370,202 (GRCm39) missense probably benign 0.32
R4597:Cdh23 UTSW 10 60,244,823 (GRCm39) missense probably damaging 1.00
R4604:Cdh23 UTSW 10 60,173,445 (GRCm39) missense possibly damaging 0.93
R4793:Cdh23 UTSW 10 60,167,129 (GRCm39) missense probably damaging 1.00
R4816:Cdh23 UTSW 10 60,244,856 (GRCm39) missense possibly damaging 0.93
R4833:Cdh23 UTSW 10 60,220,817 (GRCm39) missense probably damaging 1.00
R4840:Cdh23 UTSW 10 60,255,556 (GRCm39) missense possibly damaging 0.53
R4857:Cdh23 UTSW 10 60,227,563 (GRCm39) missense probably damaging 1.00
R4869:Cdh23 UTSW 10 60,212,713 (GRCm39) missense probably damaging 1.00
R4894:Cdh23 UTSW 10 60,173,630 (GRCm39) missense probably benign 0.04
R4940:Cdh23 UTSW 10 60,143,714 (GRCm39) missense probably damaging 0.98
R5020:Cdh23 UTSW 10 60,143,811 (GRCm39) missense probably damaging 0.99
R5026:Cdh23 UTSW 10 60,140,627 (GRCm39) missense possibly damaging 0.88
R5081:Cdh23 UTSW 10 60,272,586 (GRCm39) missense possibly damaging 0.89
R5138:Cdh23 UTSW 10 60,148,061 (GRCm39) missense probably damaging 1.00
R5236:Cdh23 UTSW 10 60,148,351 (GRCm39) missense probably damaging 1.00
R5361:Cdh23 UTSW 10 60,493,044 (GRCm39) critical splice donor site probably null
R5384:Cdh23 UTSW 10 60,173,541 (GRCm39) missense probably damaging 0.99
R5500:Cdh23 UTSW 10 60,150,090 (GRCm39) missense probably damaging 1.00
R5512:Cdh23 UTSW 10 60,370,165 (GRCm39) splice site probably null
R5673:Cdh23 UTSW 10 60,143,636 (GRCm39) missense probably damaging 1.00
R5720:Cdh23 UTSW 10 60,228,802 (GRCm39) missense possibly damaging 0.71
R5726:Cdh23 UTSW 10 60,243,259 (GRCm39) missense probably damaging 0.98
R5732:Cdh23 UTSW 10 60,167,096 (GRCm39) missense possibly damaging 0.80
R5739:Cdh23 UTSW 10 60,141,388 (GRCm39) missense probably damaging 0.99
R5760:Cdh23 UTSW 10 60,242,171 (GRCm39) missense probably damaging 0.99
R5793:Cdh23 UTSW 10 60,141,907 (GRCm39) missense probably damaging 1.00
R5880:Cdh23 UTSW 10 60,220,713 (GRCm39) missense probably damaging 1.00
R5905:Cdh23 UTSW 10 60,370,314 (GRCm39) missense probably damaging 0.98
R5907:Cdh23 UTSW 10 60,264,158 (GRCm39) missense probably damaging 1.00
R5910:Cdh23 UTSW 10 60,213,600 (GRCm39) missense possibly damaging 0.81
R5932:Cdh23 UTSW 10 60,228,763 (GRCm39) missense probably damaging 1.00
R5996:Cdh23 UTSW 10 60,249,356 (GRCm39) missense possibly damaging 0.85
R6015:Cdh23 UTSW 10 60,143,761 (GRCm39) missense probably damaging 0.97
R6020:Cdh23 UTSW 10 60,167,105 (GRCm39) missense probably damaging 1.00
R6023:Cdh23 UTSW 10 60,301,321 (GRCm39) missense probably damaging 1.00
R6028:Cdh23 UTSW 10 60,370,314 (GRCm39) missense probably damaging 0.98
R6066:Cdh23 UTSW 10 60,269,537 (GRCm39) missense probably damaging 1.00
R6137:Cdh23 UTSW 10 60,270,291 (GRCm39) missense probably damaging 0.96
R6211:Cdh23 UTSW 10 60,246,600 (GRCm39) missense possibly damaging 0.90
R6298:Cdh23 UTSW 10 60,262,451 (GRCm39) nonsense probably null
R6302:Cdh23 UTSW 10 60,140,872 (GRCm39) missense possibly damaging 0.74
R6338:Cdh23 UTSW 10 60,248,930 (GRCm39) missense probably damaging 1.00
R6356:Cdh23 UTSW 10 60,274,626 (GRCm39) missense probably damaging 1.00
R6441:Cdh23 UTSW 10 60,143,815 (GRCm39) missense probably damaging 1.00
R6714:Cdh23 UTSW 10 60,167,609 (GRCm39) missense possibly damaging 0.62
R6760:Cdh23 UTSW 10 60,141,947 (GRCm39) missense probably damaging 1.00
R6807:Cdh23 UTSW 10 60,214,650 (GRCm39) missense possibly damaging 0.95
R6855:Cdh23 UTSW 10 60,141,901 (GRCm39) missense possibly damaging 0.66
R6937:Cdh23 UTSW 10 60,322,893 (GRCm39) missense probably damaging 1.00
R6942:Cdh23 UTSW 10 60,274,635 (GRCm39) missense possibly damaging 0.93
R6961:Cdh23 UTSW 10 60,485,893 (GRCm39) missense probably benign 0.00
R7009:Cdh23 UTSW 10 60,173,085 (GRCm39) missense probably damaging 0.99
R7010:Cdh23 UTSW 10 60,366,770 (GRCm39) missense probably benign 0.03
R7032:Cdh23 UTSW 10 60,167,567 (GRCm39) missense probably damaging 1.00
R7046:Cdh23 UTSW 10 60,214,530 (GRCm39) missense probably damaging 1.00
R7111:Cdh23 UTSW 10 60,222,823 (GRCm39) missense probably damaging 1.00
R7196:Cdh23 UTSW 10 60,143,759 (GRCm39) missense probably damaging 0.99
R7198:Cdh23 UTSW 10 60,148,378 (GRCm39) missense possibly damaging 0.91
R7223:Cdh23 UTSW 10 60,167,596 (GRCm39) missense probably damaging 1.00
R7290:Cdh23 UTSW 10 60,212,620 (GRCm39) missense probably benign
R7335:Cdh23 UTSW 10 60,140,895 (GRCm39) missense probably damaging 1.00
R7340:Cdh23 UTSW 10 60,366,775 (GRCm39) missense probably benign 0.19
R7350:Cdh23 UTSW 10 60,246,689 (GRCm39) missense probably damaging 1.00
R7366:Cdh23 UTSW 10 60,151,471 (GRCm39) nonsense probably null
R7374:Cdh23 UTSW 10 60,153,679 (GRCm39) missense probably damaging 0.99
R7455:Cdh23 UTSW 10 60,142,003 (GRCm39) missense possibly damaging 0.82
R7537:Cdh23 UTSW 10 60,220,724 (GRCm39) missense probably benign 0.17
R7573:Cdh23 UTSW 10 60,159,329 (GRCm39) missense probably benign 0.17
R7578:Cdh23 UTSW 10 60,243,186 (GRCm39) missense probably benign 0.14
R7646:Cdh23 UTSW 10 60,140,931 (GRCm39) missense possibly damaging 0.95
R7703:Cdh23 UTSW 10 60,173,043 (GRCm39) missense probably damaging 1.00
R7763:Cdh23 UTSW 10 60,148,356 (GRCm39) missense probably damaging 1.00
R7797:Cdh23 UTSW 10 60,220,973 (GRCm39) missense probably benign 0.07
R7867:Cdh23 UTSW 10 60,150,390 (GRCm39) missense probably damaging 1.00
R7878:Cdh23 UTSW 10 60,149,979 (GRCm39) missense possibly damaging 0.69
R7915:Cdh23 UTSW 10 60,143,668 (GRCm39) missense probably damaging 0.97
R7922:Cdh23 UTSW 10 60,218,485 (GRCm39) missense probably benign 0.31
R7963:Cdh23 UTSW 10 60,171,967 (GRCm39) missense probably damaging 1.00
R7997:Cdh23 UTSW 10 60,432,518 (GRCm39) missense possibly damaging 0.81
R8167:Cdh23 UTSW 10 60,150,162 (GRCm39) missense probably benign 0.12
R8167:Cdh23 UTSW 10 60,173,472 (GRCm39) missense probably damaging 0.96
R8258:Cdh23 UTSW 10 60,151,435 (GRCm39) missense probably damaging 0.99
R8259:Cdh23 UTSW 10 60,151,435 (GRCm39) missense probably damaging 0.99
R8317:Cdh23 UTSW 10 60,272,568 (GRCm39) missense probably damaging 1.00
R8317:Cdh23 UTSW 10 60,147,037 (GRCm39) critical splice donor site probably null
R8326:Cdh23 UTSW 10 60,274,591 (GRCm39) missense possibly damaging 0.55
R8333:Cdh23 UTSW 10 60,150,390 (GRCm39) missense probably damaging 1.00
R8348:Cdh23 UTSW 10 60,167,507 (GRCm39) missense probably benign 0.43
R8366:Cdh23 UTSW 10 60,160,799 (GRCm39) missense probably benign
R8504:Cdh23 UTSW 10 60,274,618 (GRCm39) missense probably benign 0.00
R8676:Cdh23 UTSW 10 60,246,689 (GRCm39) missense probably damaging 1.00
R8781:Cdh23 UTSW 10 60,167,567 (GRCm39) missense probably damaging 1.00
R8785:Cdh23 UTSW 10 60,147,114 (GRCm39) missense probably damaging 1.00
R8788:Cdh23 UTSW 10 60,324,372 (GRCm39) missense probably damaging 1.00
R8802:Cdh23 UTSW 10 60,244,877 (GRCm39) missense probably benign 0.04
R8837:Cdh23 UTSW 10 60,160,755 (GRCm39) missense probably benign 0.28
R8863:Cdh23 UTSW 10 60,212,613 (GRCm39) nonsense probably null
R8889:Cdh23 UTSW 10 60,143,284 (GRCm39) missense probably damaging 0.97
R8892:Cdh23 UTSW 10 60,143,284 (GRCm39) missense probably damaging 0.97
R8921:Cdh23 UTSW 10 60,140,908 (GRCm39) missense probably damaging 0.99
R8980:Cdh23 UTSW 10 60,173,625 (GRCm39) missense probably benign 0.06
R9000:Cdh23 UTSW 10 60,140,277 (GRCm39) missense possibly damaging 0.82
R9043:Cdh23 UTSW 10 60,151,478 (GRCm39) missense probably benign 0.00
R9046:Cdh23 UTSW 10 60,218,303 (GRCm39) intron probably benign
R9070:Cdh23 UTSW 10 60,173,539 (GRCm39) missense probably benign
R9075:Cdh23 UTSW 10 60,153,541 (GRCm39) missense probably damaging 1.00
R9132:Cdh23 UTSW 10 60,270,283 (GRCm39) splice site probably benign
R9155:Cdh23 UTSW 10 60,249,485 (GRCm39) missense probably damaging 0.99
R9171:Cdh23 UTSW 10 60,161,810 (GRCm39) missense probably benign 0.00
R9179:Cdh23 UTSW 10 60,153,664 (GRCm39) missense probably benign 0.06
R9186:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9189:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9207:Cdh23 UTSW 10 60,243,210 (GRCm39) missense probably damaging 1.00
R9240:Cdh23 UTSW 10 60,215,044 (GRCm39) missense probably benign 0.00
R9244:Cdh23 UTSW 10 60,249,442 (GRCm39) missense possibly damaging 0.93
R9284:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9286:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9287:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9302:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9352:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9353:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9423:Cdh23 UTSW 10 60,148,387 (GRCm39) missense probably damaging 1.00
R9513:Cdh23 UTSW 10 60,166,995 (GRCm39) missense probably damaging 0.99
R9577:Cdh23 UTSW 10 60,146,895 (GRCm39) missense probably damaging 1.00
R9598:Cdh23 UTSW 10 60,214,574 (GRCm39) missense probably benign 0.01
R9631:Cdh23 UTSW 10 60,243,168 (GRCm39) missense possibly damaging 0.49
R9652:Cdh23 UTSW 10 60,167,135 (GRCm39) missense probably damaging 1.00
R9725:Cdh23 UTSW 10 60,432,561 (GRCm39) missense probably benign 0.02
X0052:Cdh23 UTSW 10 60,220,913 (GRCm39) missense probably damaging 1.00
Z1088:Cdh23 UTSW 10 60,249,423 (GRCm39) missense probably benign 0.35
Z1176:Cdh23 UTSW 10 60,264,100 (GRCm39) missense probably benign
Z1176:Cdh23 UTSW 10 60,146,549 (GRCm39) missense probably damaging 1.00
Z1177:Cdh23 UTSW 10 60,270,393 (GRCm39) critical splice acceptor site probably null
Z1177:Cdh23 UTSW 10 60,159,334 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACCTGCAATGGTTGCATCGTCTC -3'
(R):5'- ACAGCCTGGTTCTGGCATGTTC -3'

Sequencing Primer
(F):5'- GCCACCAAGATGAGCTAGAG -3'
(R):5'- ATGTTCCATGCCCACATGC -3'
Posted On 2015-02-04