Incidental Mutation 'ANU22:Nabp2'
ID262592
Institutional Source Beutler Lab
Gene Symbol Nabp2
Ensembl Gene ENSMUSG00000025374
Gene Namenucleic acid binding protein 2
SynonymsNabp2, 2610036N15Rik, Obfc2b
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #ANU22
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128401395-128411492 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128408762 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 52 (I52F)
Ref Sequence ENSEMBL: ENSMUSP00000127436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026439] [ENSMUST00000096386] [ENSMUST00000164199] [ENSMUST00000164664] [ENSMUST00000166608] [ENSMUST00000171342] [ENSMUST00000171370] [ENSMUST00000171494] [ENSMUST00000172238] [ENSMUST00000172348] [ENSMUST00000217826]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026439
AA Change: I52F

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026439
Gene: ENSMUSG00000025374
AA Change: I52F

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 23 105 1.7e-9 PFAM
low complexity region 131 148 N/A INTRINSIC
low complexity region 161 178 N/A INTRINSIC
low complexity region 185 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096386
SMART Domains Protein: ENSMUSP00000100869
Gene: ENSMUSG00000025373

DomainStartEndE-ValueType
RING 18 56 1.54e-5 SMART
Pfam:USP8_interact 137 315 5.1e-96 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164199
AA Change: I52F

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128634
Gene: ENSMUSG00000025374
AA Change: I52F

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 23 105 1.7e-9 PFAM
low complexity region 131 148 N/A INTRINSIC
low complexity region 161 178 N/A INTRINSIC
low complexity region 185 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164664
AA Change: I52F

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127605
Gene: ENSMUSG00000025374
AA Change: I52F

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 22 105 5.8e-10 PFAM
low complexity region 131 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166577
SMART Domains Protein: ENSMUSP00000128794
Gene: ENSMUSG00000014498

DomainStartEndE-ValueType
ANK 18 48 5.09e-2 SMART
ANK 52 81 2.54e-2 SMART
ANK 88 117 1.34e-1 SMART
Blast:ANK 121 148 3e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000166608
AA Change: I68F

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131171
Gene: ENSMUSG00000025374
AA Change: I68F

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 39 120 4.2e-9 PFAM
low complexity region 147 164 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 201 219 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167456
Predicted Effect probably benign
Transcript: ENSMUST00000171342
SMART Domains Protein: ENSMUSP00000132751
Gene: ENSMUSG00000025373

DomainStartEndE-ValueType
RING 18 56 1.54e-5 SMART
Pfam:USP8_interact 137 315 2.3e-91 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171370
AA Change: I52F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127436
Gene: ENSMUSG00000025374
AA Change: I52F

DomainStartEndE-ValueType
PDB:4OWX|B 1 56 3e-35 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000171494
AA Change: I52F

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126842
Gene: ENSMUSG00000025374
AA Change: I52F

DomainStartEndE-ValueType
PDB:4OWX|B 1 65 5e-41 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000172238
Predicted Effect probably benign
Transcript: ENSMUST00000172348
AA Change: I52F

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127015
Gene: ENSMUSG00000025374
AA Change: I52F

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 22 105 6.1e-10 PFAM
low complexity region 131 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217826
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.1%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Single-stranded DNA (ssDNA)-binding proteins, such as OBFC2B, are ubiquitous and essential for a variety of DNA metabolic processes, including replication, recombination, and detection and repair of damage (Richard et al., 2008 [PubMed 18449195]).[supplied by OMIM, Jun 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete perinatal lethality, fetal growth retardation, abnormal limb development, abnormal cranium morphology, small rib cage, thin and porous bones, cleft palate, oligodactyly, increased apoptosis at E12.5 and increased genomic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 A G 15: 81,913,714 E663G possibly damaging Het
Adam29 T A 8: 55,871,844 H525L probably benign Het
Adamts2 A G 11: 50,737,363 N297D probably benign Het
Adamts6 T A 13: 104,390,082 V506E probably damaging Het
Ankfy1 G A 11: 72,764,791 E1101K probably damaging Het
Arap3 C T 18: 37,991,327 probably null Het
Asxl3 T A 18: 22,516,446 H497Q probably benign Het
Caln1 A G 5: 130,669,551 E96G probably damaging Het
Cdh23 T C 10: 60,312,624 T2653A probably damaging Het
Cdk5rap2 T A 4: 70,380,235 I87F possibly damaging Het
Crybg3 T A 16: 59,529,227 H934L probably damaging Het
Cyp2d22 G A 15: 82,371,668 T461I probably damaging Het
Dhcr24 T C 4: 106,572,278 F183L possibly damaging Het
Dusp16 A T 6: 134,718,861 S336T probably benign Het
F930017D23Rik T G 10: 43,604,375 noncoding transcript Het
Fasl A G 1: 161,781,838 V193A probably damaging Het
Fgf5 T C 5: 98,275,316 Y187H probably damaging Het
Focad C A 4: 88,393,547 Q1423K probably benign Het
Gabrp T C 11: 33,555,055 T249A probably damaging Het
Galnt5 A T 2: 58,025,342 K637* probably null Het
Grm6 A T 11: 50,859,519 D503V probably benign Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Lyst C T 13: 13,678,056 R2214C probably benign Het
Micu2 T A 14: 57,943,625 D184V probably damaging Het
Nat8f7 A T 6: 85,707,588 L90* probably null Het
Olfr1297 T C 2: 111,621,201 N291S probably damaging Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Pphln1 A G 15: 93,489,104 E273G probably damaging Het
Ppil1 C A 17: 29,263,888 V14F possibly damaging Het
Ptprd C A 4: 76,100,456 D694Y probably damaging Het
Relt A T 7: 100,851,698 L28Q probably damaging Het
Sptbn4 G A 7: 27,357,387 R2525* probably null Het
St8sia5 G A 18: 77,254,662 G320D probably damaging Het
Taf2 T C 15: 55,048,274 E582G probably damaging Het
Tas2r116 T A 6: 132,855,443 N2K probably benign Het
Tedc1 C T 12: 113,163,188 R357* probably null Het
Tmem168 A T 6: 13,583,046 V612E probably damaging Het
Unc79 A G 12: 103,001,871 S119G probably damaging Het
Washc5 T A 15: 59,355,839 K425* probably null Het
Wdr61 C A 9: 54,728,186 V44L probably damaging Het
Wtap G T 17: 12,967,895 T255K probably benign Het
Zfp148 T C 16: 33,456,943 V134A probably benign Het
Zfp397 C T 18: 23,960,751 S431L probably damaging Het
Other mutations in Nabp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Nabp2 APN 10 128408762 missense probably damaging 0.98
IGL02397:Nabp2 APN 10 128408323 missense possibly damaging 0.46
PIT4585001:Nabp2 UTSW 10 128408807 missense possibly damaging 0.64
R1928:Nabp2 UTSW 10 128409313 missense possibly damaging 0.89
R4909:Nabp2 UTSW 10 128401687 unclassified probably benign
R5031:Nabp2 UTSW 10 128409628 unclassified probably benign
R5724:Nabp2 UTSW 10 128409686 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGTGAAGCAGGATTCGGTCTTCAG -3'
(R):5'- GGGACCACCGCTTGCATTCTTAAC -3'

Sequencing Primer
(F):5'- CAGGATTCGGTCTTCAGAAAAGTTG -3'
(R):5'- TCTTAACTTGCCTGGACAAGGAG -3'
Posted On2015-02-04