Mutagenetix > Incidental Mutation

Incidental Mutation 'ANU22:Gabrp'

262593

Institutional Source

Beutler Lab

Gene Symbol

Gabrp

Ensembl Gene

ENSMUSG00000020159

Gene Name

gamma-aminobutyric acid type A receptor subunit pi

Synonyms

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

ANU22

Quality Score

220

Status

Not validated

Chromosome

Chromosomal Location

33500781-33528959 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 33505055 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 249 (T249A)

Ref Sequence

ENSEMBL: ENSMUSP00000020366 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020366]

AlphaFold

Q8QZW7

Predicted Effect

probably damaging
Transcript: ENSMUST00000020366
AA Change: T249A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000020366
Gene: ENSMUSG00000020159
AA Change: T249A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Neur_chan_LBD	40	242	1.3e-49	PFAM
Pfam:Neur_chan_memb	249	353	5.2e-23	PFAM
transmembrane domain	420	437	N/A	INTRINSIC

Coding Region Coverage

1x: 98.7%
3x: 98.1%
10x: 96.2%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. The subunit encoded by this gene is expressed in several non-neuronal tissues including the uterus and ovaries. This subunit can assemble with known GABA A receptor subunits, and the presence of this subunit alters the sensitivity of recombinant receptors to modulatory agents such as pregnanolone. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aco2	A	G	15: 81,797,915 (GRCm39)	E663G	possibly damaging	Het
Adam29	T	A	8: 56,324,879 (GRCm39)	H525L	probably benign	Het
Adamts2	A	G	11: 50,628,190 (GRCm39)	N297D	probably benign	Het
Adamts6	T	A	13: 104,526,590 (GRCm39)	V506E	probably damaging	Het
Ankfy1	G	A	11: 72,655,617 (GRCm39)	E1101K	probably damaging	Het
Arap3	C	T	18: 38,124,380 (GRCm39)		probably null	Het
Asxl3	T	A	18: 22,649,503 (GRCm39)	H497Q	probably benign	Het
Caln1	A	G	5: 130,698,392 (GRCm39)	E96G	probably damaging	Het
Cdh23	T	C	10: 60,148,403 (GRCm39)	T2653A	probably damaging	Het
Cdk5rap2	T	A	4: 70,298,472 (GRCm39)	I87F	possibly damaging	Het
Crybg3	T	A	16: 59,349,590 (GRCm39)	H934L	probably damaging	Het
Cyp2d22	G	A	15: 82,255,869 (GRCm39)	T461I	probably damaging	Het
Dhcr24	T	C	4: 106,429,475 (GRCm39)	F183L	possibly damaging	Het
Dusp16	A	T	6: 134,695,824 (GRCm39)	S336T	probably benign	Het
F930017D23Rik	T	G	10: 43,480,371 (GRCm39)		noncoding transcript	Het
Fasl	A	G	1: 161,609,407 (GRCm39)	V193A	probably damaging	Het
Fgf5	T	C	5: 98,423,175 (GRCm39)	Y187H	probably damaging	Het
Focad	C	A	4: 88,311,784 (GRCm39)	Q1423K	probably benign	Het
Galnt5	A	T	2: 57,915,354 (GRCm39)	K637*	probably null	Het
Grm6	A	T	11: 50,750,346 (GRCm39)	D503V	probably benign	Het
Hmg20a	A	T	9: 56,394,934 (GRCm39)	D216V	probably damaging	Het
Lyst	C	T	13: 13,852,641 (GRCm39)	R2214C	probably benign	Het
Micu2	T	A	14: 58,181,082 (GRCm39)	D184V	probably damaging	Het
Nabp2	T	A	10: 128,244,631 (GRCm39)	I52F	probably damaging	Het
Nat8f7	A	T	6: 85,684,570 (GRCm39)	L90*	probably null	Het
Or2z2	A	T	11: 58,346,088 (GRCm39)	M229K	probably damaging	Het
Or4k47	T	C	2: 111,451,546 (GRCm39)	N291S	probably damaging	Het
Pphln1	A	G	15: 93,386,985 (GRCm39)	E273G	probably damaging	Het
Ppil1	C	A	17: 29,482,862 (GRCm39)	V14F	possibly damaging	Het
Ptprd	C	A	4: 76,018,693 (GRCm39)	D694Y	probably damaging	Het
Relt	A	T	7: 100,500,905 (GRCm39)	L28Q	probably damaging	Het
Skic8	C	A	9: 54,635,470 (GRCm39)	V44L	probably damaging	Het
Sptbn4	G	A	7: 27,056,812 (GRCm39)	R2525*	probably null	Het
St8sia5	G	A	18: 77,342,358 (GRCm39)	G320D	probably damaging	Het
Taf2	T	C	15: 54,911,670 (GRCm39)	E582G	probably damaging	Het
Tas2r116	T	A	6: 132,832,406 (GRCm39)	N2K	probably benign	Het
Tedc1	C	T	12: 113,126,808 (GRCm39)	R357*	probably null	Het
Tmem168	A	T	6: 13,583,045 (GRCm39)	V612E	probably damaging	Het
Unc79	A	G	12: 102,968,130 (GRCm39)	S119G	probably damaging	Het
Washc5	T	A	15: 59,227,688 (GRCm39)	K425*	probably null	Het
Wtap	G	T	17: 13,186,782 (GRCm39)	T255K	probably benign	Het
Zfp148	T	C	16: 33,277,313 (GRCm39)	V134A	probably benign	Het
Zfp397	C	T	18: 24,093,808 (GRCm39)	S431L	probably damaging	Het

Other mutations in Gabrp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00558:Gabrp	APN	11	33,502,644 (GRCm39)	missense	possibly damaging	0.91
IGL01299:Gabrp	APN	11	33,504,476 (GRCm39)	missense	probably damaging	1.00
IGL01305:Gabrp	APN	11	33,505,055 (GRCm39)	missense	probably damaging	1.00
IGL01686:Gabrp	APN	11	33,502,826 (GRCm39)	nonsense	probably null
IGL01729:Gabrp	APN	11	33,502,689 (GRCm39)	missense	probably damaging	1.00
IGL03031:Gabrp	APN	11	33,504,980 (GRCm39)	missense	probably damaging	1.00
IGL03172:Gabrp	APN	11	33,504,388 (GRCm39)	missense	probably damaging	1.00
IGL03280:Gabrp	APN	11	33,502,616 (GRCm39)	missense	probably benign	0.12
R0265:Gabrp	UTSW	11	33,502,614 (GRCm39)	missense	probably damaging	1.00
R0326:Gabrp	UTSW	11	33,504,362 (GRCm39)	missense	probably damaging	0.99
R1744:Gabrp	UTSW	11	33,522,462 (GRCm39)	missense	probably benign	0.03
R4174:Gabrp	UTSW	11	33,518,092 (GRCm39)	missense	probably damaging	1.00
R5043:Gabrp	UTSW	11	33,518,072 (GRCm39)	missense	probably benign	0.00
R5213:Gabrp	UTSW	11	33,517,211 (GRCm39)	critical splice donor site	probably null
R5290:Gabrp	UTSW	11	33,517,310 (GRCm39)	missense	probably damaging	0.99
R5665:Gabrp	UTSW	11	33,504,308 (GRCm39)	missense	possibly damaging	0.56
R6698:Gabrp	UTSW	11	33,507,017 (GRCm39)	missense	probably damaging	1.00
R8711:Gabrp	UTSW	11	33,505,023 (GRCm39)	missense	probably damaging	1.00
R8817:Gabrp	UTSW	11	33,504,464 (GRCm39)	missense	possibly damaging	0.77
R9188:Gabrp	UTSW	11	33,517,252 (GRCm39)	missense	possibly damaging	0.92
R9618:Gabrp	UTSW	11	33,504,342 (GRCm39)	nonsense	probably null
Z1176:Gabrp	UTSW	11	33,502,673 (GRCm39)	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- AGATACTAGCTCTTCTAACGGCCCC -3'
(R):5'- TAGCAGCAGCCCTGTAAATCCCTC -3'

Sequencing Primer
(F):5'- GGCCCCCAACTGTCAATG -3'
(R):5'- TTATGGTAACCAGAATGGCAGCTC -3'

Posted On

2015-02-04