Mutagenetix > Incidental Mutations

Incidental Mutation 'ANU22:Taf2'

262604

Institutional Source

Beutler Lab

Gene Symbol

Taf2

Ensembl Gene

ENSMUSG00000037343

Gene Name

TATA-box binding protein associated factor 2

Synonyms

CIF150, 150kDa, TAF2B, 4732460C16Rik, TAFII150

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

ANU22

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55015131-55072152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 55048274 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 582 (E582G)

Ref Sequence

ENSEMBL: ENSMUSP00000043733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041733]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041733
AA Change: E582G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: E582G

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M1	21	406	5.6e-17	PFAM
SCOP:d1gw5a_	606	973	6e-7	SMART
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1142	1175	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226864

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227254

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228360

Coding Region Coverage

1x: 98.7%
3x: 98.1%
10x: 96.2%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aco2	A	G	15: 81,913,714	E663G	possibly damaging	Het
Adam29	T	A	8: 55,871,844	H525L	probably benign	Het
Adamts2	A	G	11: 50,737,363	N297D	probably benign	Het
Adamts6	T	A	13: 104,390,082	V506E	probably damaging	Het
Ankfy1	G	A	11: 72,764,791	E1101K	probably damaging	Het
Arap3	C	T	18: 37,991,327		probably null	Het
Asxl3	T	A	18: 22,516,446	H497Q	probably benign	Het
Caln1	A	G	5: 130,669,551	E96G	probably damaging	Het
Cdh23	T	C	10: 60,312,624	T2653A	probably damaging	Het
Cdk5rap2	T	A	4: 70,380,235	I87F	possibly damaging	Het
Crybg3	T	A	16: 59,529,227	H934L	probably damaging	Het
Cyp2d22	G	A	15: 82,371,668	T461I	probably damaging	Het
Dhcr24	T	C	4: 106,572,278	F183L	possibly damaging	Het
Dusp16	A	T	6: 134,718,861	S336T	probably benign	Het
F930017D23Rik	T	G	10: 43,604,375		noncoding transcript	Het
Fasl	A	G	1: 161,781,838	V193A	probably damaging	Het
Fgf5	T	C	5: 98,275,316	Y187H	probably damaging	Het
Focad	C	A	4: 88,393,547	Q1423K	probably benign	Het
Gabrp	T	C	11: 33,555,055	T249A	probably damaging	Het
Galnt5	A	T	2: 58,025,342	K637*	probably null	Het
Grm6	A	T	11: 50,859,519	D503V	probably benign	Het
Hmg20a	A	T	9: 56,487,650	D216V	probably damaging	Het
Lyst	C	T	13: 13,678,056	R2214C	probably benign	Het
Micu2	T	A	14: 57,943,625	D184V	probably damaging	Het
Nabp2	T	A	10: 128,408,762	I52F	probably damaging	Het
Nat8f7	A	T	6: 85,707,588	L90*	probably null	Het
Olfr1297	T	C	2: 111,621,201	N291S	probably damaging	Het
Olfr30	A	T	11: 58,455,262	M229K	probably damaging	Het
Pphln1	A	G	15: 93,489,104	E273G	probably damaging	Het
Ppil1	C	A	17: 29,263,888	V14F	possibly damaging	Het
Ptprd	C	A	4: 76,100,456	D694Y	probably damaging	Het
Relt	A	T	7: 100,851,698	L28Q	probably damaging	Het
Sptbn4	G	A	7: 27,357,387	R2525*	probably null	Het
St8sia5	G	A	18: 77,254,662	G320D	probably damaging	Het
Tas2r116	T	A	6: 132,855,443	N2K	probably benign	Het
Tedc1	C	T	12: 113,163,188	R357*	probably null	Het
Tmem168	A	T	6: 13,583,046	V612E	probably damaging	Het
Unc79	A	G	12: 103,001,871	S119G	probably damaging	Het
Washc5	T	A	15: 59,355,839	K425*	probably null	Het
Wdr61	C	A	9: 54,728,186	V44L	probably damaging	Het
Wtap	G	T	17: 12,967,895	T255K	probably benign	Het
Zfp148	T	C	16: 33,456,943	V134A	probably benign	Het
Zfp397	C	T	18: 23,960,751	S431L	probably damaging	Het

Other mutations in Taf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Taf2	APN	15	55071449	critical splice acceptor site	probably null
IGL00475:Taf2	APN	15	55055850	nonsense	probably null
IGL00549:Taf2	APN	15	55031115	missense	probably benign	0.03
IGL00839:Taf2	APN	15	55045778	nonsense	probably null
IGL01089:Taf2	APN	15	55016581	missense	probably benign
IGL01305:Taf2	APN	15	55048274	missense	probably damaging	0.99
IGL01532:Taf2	APN	15	55049486	missense	possibly damaging	0.94
IGL01903:Taf2	APN	15	55060016	missense	probably benign	0.03
IGL02324:Taf2	APN	15	55028376	missense	probably benign
IGL02328:Taf2	APN	15	55028376	missense	probably benign
IGL02405:Taf2	APN	15	55034155	splice site	probably benign
IGL02671:Taf2	APN	15	55034176	missense	probably benign	0.01
IGL02832:Taf2	APN	15	55016563	missense	probably benign	0.01
IGL03105:Taf2	APN	15	55045799	missense	probably benign	0.26
IGL03118:Taf2	APN	15	55052163	missense	probably damaging	1.00
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0183:Taf2	UTSW	15	55055790	missense	possibly damaging	0.89
R0326:Taf2	UTSW	15	55047460	missense	probably damaging	0.97
R0362:Taf2	UTSW	15	55045929	missense	probably damaging	1.00
R0423:Taf2	UTSW	15	55064682	missense	probably benign	0.02
R0562:Taf2	UTSW	15	55022188	splice site	probably benign
R0609:Taf2	UTSW	15	55060050	missense	probably damaging	1.00
R0655:Taf2	UTSW	15	55038294	missense	probably damaging	1.00
R0689:Taf2	UTSW	15	55063065	missense	possibly damaging	0.60
R0743:Taf2	UTSW	15	55016461	small deletion	probably benign
R0898:Taf2	UTSW	15	55060084	missense	probably damaging	0.97
R0969:Taf2	UTSW	15	55031157	critical splice acceptor site	probably null
R0974:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1160:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R1376:Taf2	UTSW	15	55016461	small deletion	probably benign
R1388:Taf2	UTSW	15	55036625	missense	probably benign	0.00
R1416:Taf2	UTSW	15	55038410	missense	possibly damaging	0.95
R1458:Taf2	UTSW	15	55059915	missense	probably damaging	0.99
R1477:Taf2	UTSW	15	55062172	missense	possibly damaging	0.87
R1755:Taf2	UTSW	15	55016454	missense	probably damaging	1.00
R1766:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R2090:Taf2	UTSW	15	55016486	missense	probably damaging	0.99
R2228:Taf2	UTSW	15	55064646	missense	possibly damaging	0.94
R2519:Taf2	UTSW	15	55052247	missense	probably benign	0.03
R4073:Taf2	UTSW	15	55052237	missense	probably damaging	1.00
R4470:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4471:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4472:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4716:Taf2	UTSW	15	55065968	missense	probably benign	0.02
R4937:Taf2	UTSW	15	55027223	nonsense	probably null
R5082:Taf2	UTSW	15	55060045	missense	probably benign	0.41
R5335:Taf2	UTSW	15	55045740	missense	probably benign	0.14
R5383:Taf2	UTSW	15	55049419	missense	possibly damaging	0.78
R5771:Taf2	UTSW	15	55059939	missense	probably benign	0.01
R5862:Taf2	UTSW	15	55048323	missense	possibly damaging	0.95
R5873:Taf2	UTSW	15	55038422	missense	probably benign	0.00
R5908:Taf2	UTSW	15	55072006	unclassified	probably benign
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6159:Taf2	UTSW	15	55063044	missense	possibly damaging	0.48
R6568:Taf2	UTSW	15	55064630	missense	probably damaging	1.00
R7094:Taf2	UTSW	15	55060086	missense	probably benign	0.27
R7174:Taf2	UTSW	15	55048739	missense	possibly damaging	0.51
R7241:Taf2	UTSW	15	55062141	missense	probably benign	0.01
R7561:Taf2	UTSW	15	55055833	missense	probably benign	0.16
R7583:Taf2	UTSW	15	55064676	nonsense	probably null
R7818:Taf2	UTSW	15	55065930	missense	probably benign
R7905:Taf2	UTSW	15	55047432	missense	possibly damaging	0.90
R7988:Taf2	UTSW	15	55047432	missense	possibly damaging	0.90
R8006:Taf2	UTSW	15	55048701	missense	probably damaging	1.00
R8019:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- GCAGGTAAGATGTTCTTCCTCAGGC -3'
(R):5'- TGGCACCCAGAAGTACGTGGTAAG -3'

Sequencing Primer
(F):5'- AGATGTTCTTCCTCAGGCTACATAAC -3'
(R):5'- CTCAAACTGGGGTTACTGGCTAC -3'

Posted On

2015-02-04