Mutagenetix > Incidental Mutation

Incidental Mutation 'ANU22:Cyp2d22'

262607

Institutional Source

Beutler Lab

Gene Symbol

Cyp2d22

Ensembl Gene

ENSMUSG00000061740

Gene Name

cytochrome P450, family 2, subfamily d, polypeptide 22

Synonyms

2D22

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

ANU22

Quality Score

167

Status

Not validated

Chromosome

Chromosomal Location

82370527-82380260 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 82371668 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 461 (T461I)

Ref Sequence

ENSEMBL: ENSMUSP00000023083 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023083] [ENSMUST00000228986]

AlphaFold

Q9JKY7

Predicted Effect

probably damaging
Transcript: ENSMUST00000023083
AA Change: T461I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000023083
Gene: ENSMUSG00000061740
AA Change: T461I

Domain	Start	End	E-Value	Type
transmembrane domain	9	28	N/A	INTRINSIC
Pfam:p450	37	497	8.1e-139	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000228986
AA Change: T223I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229438

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229599

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230370

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230663

Coding Region Coverage

1x: 98.7%
3x: 98.1%
10x: 96.2%
20x: 92.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aco2	A	G	15: 81,913,714	E663G	possibly damaging	Het
Adam29	T	A	8: 55,871,844	H525L	probably benign	Het
Adamts2	A	G	11: 50,737,363	N297D	probably benign	Het
Adamts6	T	A	13: 104,390,082	V506E	probably damaging	Het
Ankfy1	G	A	11: 72,764,791	E1101K	probably damaging	Het
Arap3	C	T	18: 37,991,327		probably null	Het
Asxl3	T	A	18: 22,516,446	H497Q	probably benign	Het
Caln1	A	G	5: 130,669,551	E96G	probably damaging	Het
Cdh23	T	C	10: 60,312,624	T2653A	probably damaging	Het
Cdk5rap2	T	A	4: 70,380,235	I87F	possibly damaging	Het
Crybg3	T	A	16: 59,529,227	H934L	probably damaging	Het
Dhcr24	T	C	4: 106,572,278	F183L	possibly damaging	Het
Dusp16	A	T	6: 134,718,861	S336T	probably benign	Het
F930017D23Rik	T	G	10: 43,604,375		noncoding transcript	Het
Fasl	A	G	1: 161,781,838	V193A	probably damaging	Het
Fgf5	T	C	5: 98,275,316	Y187H	probably damaging	Het
Focad	C	A	4: 88,393,547	Q1423K	probably benign	Het
Gabrp	T	C	11: 33,555,055	T249A	probably damaging	Het
Galnt5	A	T	2: 58,025,342	K637*	probably null	Het
Grm6	A	T	11: 50,859,519	D503V	probably benign	Het
Hmg20a	A	T	9: 56,487,650	D216V	probably damaging	Het
Lyst	C	T	13: 13,678,056	R2214C	probably benign	Het
Micu2	T	A	14: 57,943,625	D184V	probably damaging	Het
Nabp2	T	A	10: 128,408,762	I52F	probably damaging	Het
Nat8f7	A	T	6: 85,707,588	L90*	probably null	Het
Olfr1297	T	C	2: 111,621,201	N291S	probably damaging	Het
Olfr30	A	T	11: 58,455,262	M229K	probably damaging	Het
Pphln1	A	G	15: 93,489,104	E273G	probably damaging	Het
Ppil1	C	A	17: 29,263,888	V14F	possibly damaging	Het
Ptprd	C	A	4: 76,100,456	D694Y	probably damaging	Het
Relt	A	T	7: 100,851,698	L28Q	probably damaging	Het
Sptbn4	G	A	7: 27,357,387	R2525*	probably null	Het
St8sia5	G	A	18: 77,254,662	G320D	probably damaging	Het
Taf2	T	C	15: 55,048,274	E582G	probably damaging	Het
Tas2r116	T	A	6: 132,855,443	N2K	probably benign	Het
Tedc1	C	T	12: 113,163,188	R357*	probably null	Het
Tmem168	A	T	6: 13,583,046	V612E	probably damaging	Het
Unc79	A	G	12: 103,001,871	S119G	probably damaging	Het
Washc5	T	A	15: 59,355,839	K425*	probably null	Het
Wdr61	C	A	9: 54,728,186	V44L	probably damaging	Het
Wtap	G	T	17: 12,967,895	T255K	probably benign	Het
Zfp148	T	C	16: 33,456,943	V134A	probably benign	Het
Zfp397	C	T	18: 23,960,751	S431L	probably damaging	Het

Other mutations in Cyp2d22

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01305:Cyp2d22	APN	15	82371668	missense	probably damaging	1.00
IGL01750:Cyp2d22	APN	15	82374369	missense	probably benign	0.12
IGL01801:Cyp2d22	APN	15	82372845	missense	probably benign	0.41
IGL02449:Cyp2d22	APN	15	82373241	missense	probably benign	0.00
R0165:Cyp2d22	UTSW	15	82373280	missense	probably benign	0.06
R0294:Cyp2d22	UTSW	15	82374445	missense	possibly damaging	0.86
R1381:Cyp2d22	UTSW	15	82372508	missense	probably benign	0.00
R1479:Cyp2d22	UTSW	15	82371936	missense	probably damaging	0.97
R1562:Cyp2d22	UTSW	15	82373978	missense	probably damaging	0.99
R1968:Cyp2d22	UTSW	15	82373172	missense	probably benign	0.04
R1972:Cyp2d22	UTSW	15	82375827	missense	probably benign	0.11
R4492:Cyp2d22	UTSW	15	82374370	missense	probably benign	0.00
R4575:Cyp2d22	UTSW	15	82371932	missense	possibly damaging	0.94
R4702:Cyp2d22	UTSW	15	82375917	missense	probably damaging	1.00
R4703:Cyp2d22	UTSW	15	82375917	missense	probably damaging	1.00
R5344:Cyp2d22	UTSW	15	82371638	missense	possibly damaging	0.95
R5523:Cyp2d22	UTSW	15	82372571	missense	probably damaging	1.00
R5888:Cyp2d22	UTSW	15	82373813	missense	probably benign
R6060:Cyp2d22	UTSW	15	82375885	missense	probably benign	0.00
R6108:Cyp2d22	UTSW	15	82371905	missense	possibly damaging	0.59
R6146:Cyp2d22	UTSW	15	82373835	critical splice acceptor site	probably null
R6279:Cyp2d22	UTSW	15	82373968	missense	probably damaging	1.00
R6563:Cyp2d22	UTSW	15	82371912	missense	probably damaging	1.00
R7597:Cyp2d22	UTSW	15	82375852	missense	probably damaging	1.00
R7709:Cyp2d22	UTSW	15	82374411	missense	possibly damaging	0.88
R7839:Cyp2d22	UTSW	15	82372571	missense	probably damaging	1.00
R8094:Cyp2d22	UTSW	15	82374355	missense	probably benign	0.19
R8302:Cyp2d22	UTSW	15	82371820	critical splice donor site	probably null
R8515:Cyp2d22	UTSW	15	82373912	missense	probably benign	0.27
R9245:Cyp2d22	UTSW	15	82372547	missense	probably damaging	0.97
R9323:Cyp2d22	UTSW	15	82374006	missense	probably damaging	1.00
R9521:Cyp2d22	UTSW	15	82372487	missense	probably damaging	1.00
Z1186:Cyp2d22	UTSW	15	82375885	missense	probably benign	0.00
Z1190:Cyp2d22	UTSW	15	82375885	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTGCACATTAGGACCCCAGCAAG -3'
(R):5'- CCGCGCTAAAAGATGAGACTGTCTG -3'

Sequencing Primer
(F):5'- GCACAGTGAGTGAGATGTCATAC -3'
(R):5'- ATCCTGAACACTTCCTGGATG -3'

Posted On

2015-02-04