Incidental Mutation 'ANU23:Serpinb3b'
ID262619
Institutional Source Beutler Lab
Gene Symbol Serpinb3b
Ensembl Gene ENSMUSG00000073602
Gene Nameserine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3B
SynonymsScca2-rs
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #ANU23
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location107153940-107278361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107154665 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 290 (Y290H)
Ref Sequence ENSEMBL: ENSMUSP00000132370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086694] [ENSMUST00000166100]
Predicted Effect probably damaging
Transcript: ENSMUST00000086694
AA Change: Y290H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083901
Gene: ENSMUSG00000073602
AA Change: Y290H

DomainStartEndE-ValueType
SERPIN 13 387 4.75e-181 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166100
AA Change: Y290H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132370
Gene: ENSMUSG00000073602
AA Change: Y290H

DomainStartEndE-ValueType
SERPIN 13 387 4.75e-181 SMART
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.2%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b G A 12: 70,169,048 G88S probably damaging Het
Acot10 A G 15: 20,665,965 F230S probably benign Het
Akap12 G T 10: 4,353,273 A28S probably benign Het
Anks1 C A 17: 27,986,253 T262K probably damaging Het
Arfgap3 A G 15: 83,313,509 Y349H possibly damaging Het
Cacna1g G A 11: 94,466,228 probably benign Het
Camsap2 T A 1: 136,297,790 E199D probably benign Het
Ccdc13 A T 9: 121,827,363 M128K probably benign Het
Ccdc38 T C 10: 93,569,935 probably null Het
Cep95 G A 11: 106,813,815 V499I probably benign Het
Cpne6 G C 14: 55,512,002 M6I probably benign Het
Cpne6 A T 14: 55,515,249 I299F probably damaging Het
Cse1l T A 2: 166,927,508 Y278* probably null Het
Dip2c A G 13: 9,575,143 N558D possibly damaging Het
Edar A T 10: 58,628,638 C60S probably damaging Het
Fat2 T C 11: 55,310,872 N459D probably benign Het
Fbxw8 C T 5: 118,113,720 V243M possibly damaging Het
Fem1b G A 9: 62,797,528 A150V possibly damaging Het
Gm5422 A T 10: 31,249,436 noncoding transcript Het
Gpatch3 CAGGAGGAGGAGGAGGAG CAGGAGGAGGAGGAG 4: 133,578,302 probably benign Het
Grin2c T C 11: 115,256,194 T392A probably benign Het
Idh3a T A 9: 54,586,545 probably null Het
Itpk1 T C 12: 102,606,103 E117G probably damaging Het
Kif12 G T 4: 63,165,884 P627Q probably damaging Het
Krtap15 T A 16: 88,829,367 F88L probably benign Het
Mcm7 C T 5: 138,170,391 V13I probably benign Het
Mlh1 T C 9: 111,252,912 N248D possibly damaging Het
Olfr617 T C 7: 103,584,693 Y224H probably damaging Het
Olfr727 A G 14: 50,126,582 N2D probably benign Het
Olfr94 T C 17: 37,196,942 N342S probably benign Het
Per2 T C 1: 91,448,833 H106R probably damaging Het
Pfkl T A 10: 77,991,395 T486S probably benign Het
Prkdc T C 16: 15,667,731 V474A possibly damaging Het
Scamp4 C A 10: 80,609,422 Q34K probably damaging Het
Sft2d2 G T 1: 165,183,995 A110E probably benign Het
Siglecf T A 7: 43,351,953 L115* probably null Het
Slc6a11 C T 6: 114,134,665 T103M probably damaging Het
Slco1a1 T A 6: 141,946,587 K18* probably null Het
Spata1 A T 3: 146,487,399 Y112* probably null Het
Tbc1d32 G A 10: 56,180,524 T440I probably benign Het
Vmn1r159 A G 7: 22,843,163 V148A probably damaging Het
Wnt16 C T 6: 22,297,935 R267C probably damaging Het
Xylt1 A C 7: 117,548,890 S230R probably benign Het
Zfp334 T C 2: 165,381,097 H342R probably damaging Het
Other mutations in Serpinb3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Serpinb3b APN 1 107157681 missense probably benign 0.20
IGL00543:Serpinb3b APN 1 107157666 critical splice donor site probably null
IGL00846:Serpinb3b APN 1 107155849 missense probably damaging 1.00
IGL00851:Serpinb3b APN 1 107159705 missense probably damaging 1.00
IGL01017:Serpinb3b APN 1 107154457 missense probably benign 0.31
IGL01083:Serpinb3b APN 1 107157743 missense possibly damaging 0.57
IGL01300:Serpinb3b APN 1 107155843 critical splice donor site probably benign
IGL01306:Serpinb3b APN 1 107154665 missense probably damaging 1.00
IGL01604:Serpinb3b APN 1 107154724 missense probably benign 0.00
IGL01936:Serpinb3b APN 1 107154638 missense probably benign 0.13
IGL02125:Serpinb3b APN 1 107154744 missense probably damaging 1.00
IGL03185:Serpinb3b APN 1 107156932 missense probably benign 0.01
R0329:Serpinb3b UTSW 1 107159703 missense probably damaging 1.00
R0330:Serpinb3b UTSW 1 107159703 missense probably damaging 1.00
R1465:Serpinb3b UTSW 1 107155843 critical splice donor site probably null
R1465:Serpinb3b UTSW 1 107155843 critical splice donor site probably null
R1635:Serpinb3b UTSW 1 107154673 missense probably benign 0.16
R1713:Serpinb3b UTSW 1 107155434 missense probably benign 0.00
R1898:Serpinb3b UTSW 1 107154587 missense possibly damaging 0.85
R2252:Serpinb3b UTSW 1 107155478 missense possibly damaging 0.71
R3430:Serpinb3b UTSW 1 107154695 missense probably benign 0.21
R4382:Serpinb3b UTSW 1 107155543 missense probably damaging 0.97
R4741:Serpinb3b UTSW 1 107154470 missense probably benign 0.01
R4855:Serpinb3b UTSW 1 107154540 missense possibly damaging 0.59
R4974:Serpinb3b UTSW 1 107154715 missense probably benign 0.01
R4982:Serpinb3b UTSW 1 107157754 missense probably benign 0.03
R5519:Serpinb3b UTSW 1 107159776 start codon destroyed probably null 1.00
R6846:Serpinb3b UTSW 1 107154673 missense probably benign 0.16
R7815:Serpinb3b UTSW 1 107156895 missense probably damaging 1.00
R7860:Serpinb3b UTSW 1 107157737 missense probably damaging 1.00
R7943:Serpinb3b UTSW 1 107157737 missense probably damaging 1.00
Z1088:Serpinb3b UTSW 1 107157751 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGACTTCCACTCCTGTGGCA -3'
(R):5'- ACAGCCTGAATCACAATGCAGACTT -3'

Sequencing Primer
(F):5'- GCAGCAGCAGCTTCTGTTC -3'
(R):5'- TATAGATGGCTGGGAGCATAAAC -3'
Posted On2015-02-04