Incidental Mutation 'ANU23:Cse1l'
ID262623
Institutional Source Beutler Lab
Gene Symbol Cse1l
Ensembl Gene ENSMUSG00000002718
Gene Namechromosome segregation 1-like (S. cerevisiae)
SynonymsCapts, Xpo2, 2610100P18Rik, Cas
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #ANU23
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location166906040-166946389 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 166927508 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 278 (Y278*)
Ref Sequence ENSEMBL: ENSMUSP00000128376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]
Predicted Effect probably null
Transcript: ENSMUST00000002790
AA Change: Y278*
SMART Domains Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: Y278*

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 526 9.2e-169 PFAM
Pfam:CAS_CSE1 527 962 1.1e-181 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135139
Predicted Effect probably benign
Transcript: ENSMUST00000163437
SMART Domains Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
Pfam:Cse1 1 237 7.9e-105 PFAM
Pfam:CAS_CSE1 225 649 2.3e-195 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166871
Predicted Effect probably benign
Transcript: ENSMUST00000168599
SMART Domains Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 256 8.6e-40 PFAM
Pfam:Cse1 255 470 7.3e-99 PFAM
Pfam:CAS_CSE1 471 906 1.3e-201 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169290
AA Change: Y278*
SMART Domains Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718
AA Change: Y278*

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 389 5.2e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171410
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.2%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b G A 12: 70,169,048 G88S probably damaging Het
Acot10 A G 15: 20,665,965 F230S probably benign Het
Akap12 G T 10: 4,353,273 A28S probably benign Het
Anks1 C A 17: 27,986,253 T262K probably damaging Het
Arfgap3 A G 15: 83,313,509 Y349H possibly damaging Het
Cacna1g G A 11: 94,466,228 probably benign Het
Camsap2 T A 1: 136,297,790 E199D probably benign Het
Ccdc13 A T 9: 121,827,363 M128K probably benign Het
Ccdc38 T C 10: 93,569,935 probably null Het
Cep95 G A 11: 106,813,815 V499I probably benign Het
Cpne6 G C 14: 55,512,002 M6I probably benign Het
Cpne6 A T 14: 55,515,249 I299F probably damaging Het
Dip2c A G 13: 9,575,143 N558D possibly damaging Het
Edar A T 10: 58,628,638 C60S probably damaging Het
Fat2 T C 11: 55,310,872 N459D probably benign Het
Fbxw8 C T 5: 118,113,720 V243M possibly damaging Het
Fem1b G A 9: 62,797,528 A150V possibly damaging Het
Gm5422 A T 10: 31,249,436 noncoding transcript Het
Gpatch3 CAGGAGGAGGAGGAGGAG CAGGAGGAGGAGGAG 4: 133,578,302 probably benign Het
Grin2c T C 11: 115,256,194 T392A probably benign Het
Idh3a T A 9: 54,586,545 probably null Het
Itpk1 T C 12: 102,606,103 E117G probably damaging Het
Kif12 G T 4: 63,165,884 P627Q probably damaging Het
Krtap15 T A 16: 88,829,367 F88L probably benign Het
Mcm7 C T 5: 138,170,391 V13I probably benign Het
Mlh1 T C 9: 111,252,912 N248D possibly damaging Het
Olfr617 T C 7: 103,584,693 Y224H probably damaging Het
Olfr727 A G 14: 50,126,582 N2D probably benign Het
Olfr94 T C 17: 37,196,942 N342S probably benign Het
Per2 T C 1: 91,448,833 H106R probably damaging Het
Pfkl T A 10: 77,991,395 T486S probably benign Het
Prkdc T C 16: 15,667,731 V474A possibly damaging Het
Scamp4 C A 10: 80,609,422 Q34K probably damaging Het
Serpinb3b A G 1: 107,154,665 Y290H probably damaging Het
Sft2d2 G T 1: 165,183,995 A110E probably benign Het
Siglecf T A 7: 43,351,953 L115* probably null Het
Slc6a11 C T 6: 114,134,665 T103M probably damaging Het
Slco1a1 T A 6: 141,946,587 K18* probably null Het
Spata1 A T 3: 146,487,399 Y112* probably null Het
Tbc1d32 G A 10: 56,180,524 T440I probably benign Het
Vmn1r159 A G 7: 22,843,163 V148A probably damaging Het
Wnt16 C T 6: 22,297,935 R267C probably damaging Het
Xylt1 A C 7: 117,548,890 S230R probably benign Het
Zfp334 T C 2: 165,381,097 H342R probably damaging Het
Other mutations in Cse1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cse1l APN 2 166927804 missense probably damaging 1.00
IGL01306:Cse1l APN 2 166927508 nonsense probably null
IGL01672:Cse1l APN 2 166929967 missense probably damaging 1.00
IGL02060:Cse1l APN 2 166930653 missense probably damaging 1.00
IGL02897:Cse1l APN 2 166919708 missense possibly damaging 0.47
IGL03375:Cse1l APN 2 166943057 splice site probably benign
PIT4585001:Cse1l UTSW 2 166941474 missense probably damaging 1.00
R0195:Cse1l UTSW 2 166940088 missense probably benign
R1114:Cse1l UTSW 2 166941203 splice site probably benign
R1539:Cse1l UTSW 2 166926372 missense probably benign 0.00
R1721:Cse1l UTSW 2 166926411 missense probably damaging 1.00
R1779:Cse1l UTSW 2 166940124 splice site probably null
R1913:Cse1l UTSW 2 166922191 missense probably damaging 1.00
R2069:Cse1l UTSW 2 166941492 missense probably benign 0.01
R2398:Cse1l UTSW 2 166928997 missense probably damaging 1.00
R4110:Cse1l UTSW 2 166942050 missense probably benign 0.00
R4195:Cse1l UTSW 2 166929979 missense probably damaging 1.00
R4603:Cse1l UTSW 2 166944532 missense probably benign 0.09
R4686:Cse1l UTSW 2 166932160 missense probably damaging 1.00
R4867:Cse1l UTSW 2 166926403 missense possibly damaging 0.76
R4942:Cse1l UTSW 2 166929794 missense probably damaging 1.00
R5164:Cse1l UTSW 2 166944428 missense probably benign 0.02
R5475:Cse1l UTSW 2 166941254 missense probably damaging 1.00
R5493:Cse1l UTSW 2 166941190 intron probably benign
R5782:Cse1l UTSW 2 166929001 missense probably damaging 1.00
R5862:Cse1l UTSW 2 166915207 missense probably benign 0.00
R6030:Cse1l UTSW 2 166919621 missense probably benign 0.01
R6030:Cse1l UTSW 2 166919621 missense probably benign 0.01
R6913:Cse1l UTSW 2 166929877 missense possibly damaging 0.65
R7683:Cse1l UTSW 2 166922788 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACAGCAGACTTACTAGGCCGATG -3'
(R):5'- AGCGTGTTCTGGTCCTCAAACAG -3'

Sequencing Primer
(F):5'- TAGGCCGATGATTCAACTGC -3'
(R):5'- GCCAGAAACTGAATTGCATTGC -3'
Posted On2015-02-04