Mutagenetix > Incidental Mutations

Incidental Mutation 'ANU23:Cse1l'

262623

Institutional Source

Beutler Lab

Gene Symbol

Cse1l

Ensembl Gene

ENSMUSG00000002718

Gene Name

chromosome segregation 1-like (S. cerevisiae)

Synonyms

Capts, Xpo2, 2610100P18Rik, Cas

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

ANU23

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

166906040-166946389 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 166927508 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 278 (Y278*)

Ref Sequence

ENSEMBL: ENSMUSP00000128376 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]

Predicted Effect

probably null
Transcript: ENSMUST00000002790
AA Change: Y278*

SMART Domains

Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: Y278*

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	526	9.2e-169	PFAM
Pfam:CAS_CSE1	527	962	1.1e-181	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132402

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135139

Predicted Effect

probably benign
Transcript: ENSMUST00000163437

SMART Domains

Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718

Domain	Start	End	E-Value	Type
Pfam:Cse1	1	237	7.9e-105	PFAM
Pfam:CAS_CSE1	225	649	2.3e-195	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166871

Predicted Effect

probably benign
Transcript: ENSMUST00000168599

SMART Domains

Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	256	8.6e-40	PFAM
Pfam:Cse1	255	470	7.3e-99	PFAM
Pfam:CAS_CSE1	471	906	1.3e-201	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000169290
AA Change: Y278*

SMART Domains

Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718
AA Change: Y278*

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	389	5.2e-102	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171410

Coding Region Coverage

1x: 98.7%
3x: 98.2%
10x: 96.6%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd12b	G	A	12: 70,169,048	G88S	probably damaging	Het
Acot10	A	G	15: 20,665,965	F230S	probably benign	Het
Akap12	G	T	10: 4,353,273	A28S	probably benign	Het
Anks1	C	A	17: 27,986,253	T262K	probably damaging	Het
Arfgap3	A	G	15: 83,313,509	Y349H	possibly damaging	Het
Cacna1g	G	A	11: 94,466,228		probably benign	Het
Camsap2	T	A	1: 136,297,790	E199D	probably benign	Het
Ccdc13	A	T	9: 121,827,363	M128K	probably benign	Het
Ccdc38	T	C	10: 93,569,935		probably null	Het
Cep95	G	A	11: 106,813,815	V499I	probably benign	Het
Cpne6	G	C	14: 55,512,002	M6I	probably benign	Het
Cpne6	A	T	14: 55,515,249	I299F	probably damaging	Het
Dip2c	A	G	13: 9,575,143	N558D	possibly damaging	Het
Edar	A	T	10: 58,628,638	C60S	probably damaging	Het
Fat2	T	C	11: 55,310,872	N459D	probably benign	Het
Fbxw8	C	T	5: 118,113,720	V243M	possibly damaging	Het
Fem1b	G	A	9: 62,797,528	A150V	possibly damaging	Het
Gm5422	A	T	10: 31,249,436		noncoding transcript	Het
Gpatch3	CAGGAGGAGGAGGAGGAG	CAGGAGGAGGAGGAG	4: 133,578,302		probably benign	Het
Grin2c	T	C	11: 115,256,194	T392A	probably benign	Het
Idh3a	T	A	9: 54,586,545		probably null	Het
Itpk1	T	C	12: 102,606,103	E117G	probably damaging	Het
Kif12	G	T	4: 63,165,884	P627Q	probably damaging	Het
Krtap15	T	A	16: 88,829,367	F88L	probably benign	Het
Mcm7	C	T	5: 138,170,391	V13I	probably benign	Het
Mlh1	T	C	9: 111,252,912	N248D	possibly damaging	Het
Olfr617	T	C	7: 103,584,693	Y224H	probably damaging	Het
Olfr727	A	G	14: 50,126,582	N2D	probably benign	Het
Olfr94	T	C	17: 37,196,942	N342S	probably benign	Het
Per2	T	C	1: 91,448,833	H106R	probably damaging	Het
Pfkl	T	A	10: 77,991,395	T486S	probably benign	Het
Prkdc	T	C	16: 15,667,731	V474A	possibly damaging	Het
Scamp4	C	A	10: 80,609,422	Q34K	probably damaging	Het
Serpinb3b	A	G	1: 107,154,665	Y290H	probably damaging	Het
Sft2d2	G	T	1: 165,183,995	A110E	probably benign	Het
Siglecf	T	A	7: 43,351,953	L115*	probably null	Het
Slc6a11	C	T	6: 114,134,665	T103M	probably damaging	Het
Slco1a1	T	A	6: 141,946,587	K18*	probably null	Het
Spata1	A	T	3: 146,487,399	Y112*	probably null	Het
Tbc1d32	G	A	10: 56,180,524	T440I	probably benign	Het
Vmn1r159	A	G	7: 22,843,163	V148A	probably damaging	Het
Wnt16	C	T	6: 22,297,935	R267C	probably damaging	Het
Xylt1	A	C	7: 117,548,890	S230R	probably benign	Het
Zfp334	T	C	2: 165,381,097	H342R	probably damaging	Het

Other mutations in Cse1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Cse1l	APN	2	166927804	missense	probably damaging	1.00
IGL01306:Cse1l	APN	2	166927508	nonsense	probably null
IGL01672:Cse1l	APN	2	166929967	missense	probably damaging	1.00
IGL02060:Cse1l	APN	2	166930653	missense	probably damaging	1.00
IGL02897:Cse1l	APN	2	166919708	missense	possibly damaging	0.47
IGL03375:Cse1l	APN	2	166943057	splice site	probably benign
PIT4585001:Cse1l	UTSW	2	166941474	missense	probably damaging	1.00
R0195:Cse1l	UTSW	2	166940088	missense	probably benign
R1114:Cse1l	UTSW	2	166941203	splice site	probably benign
R1539:Cse1l	UTSW	2	166926372	missense	probably benign	0.00
R1721:Cse1l	UTSW	2	166926411	missense	probably damaging	1.00
R1779:Cse1l	UTSW	2	166940124	splice site	probably null
R1913:Cse1l	UTSW	2	166922191	missense	probably damaging	1.00
R2069:Cse1l	UTSW	2	166941492	missense	probably benign	0.01
R2398:Cse1l	UTSW	2	166928997	missense	probably damaging	1.00
R4110:Cse1l	UTSW	2	166942050	missense	probably benign	0.00
R4195:Cse1l	UTSW	2	166929979	missense	probably damaging	1.00
R4603:Cse1l	UTSW	2	166944532	missense	probably benign	0.09
R4686:Cse1l	UTSW	2	166932160	missense	probably damaging	1.00
R4867:Cse1l	UTSW	2	166926403	missense	possibly damaging	0.76
R4942:Cse1l	UTSW	2	166929794	missense	probably damaging	1.00
R5164:Cse1l	UTSW	2	166944428	missense	probably benign	0.02
R5475:Cse1l	UTSW	2	166941254	missense	probably damaging	1.00
R5493:Cse1l	UTSW	2	166941190	intron	probably benign
R5782:Cse1l	UTSW	2	166929001	missense	probably damaging	1.00
R5862:Cse1l	UTSW	2	166915207	missense	probably benign	0.00
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6913:Cse1l	UTSW	2	166929877	missense	possibly damaging	0.65
R7683:Cse1l	UTSW	2	166922788	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGACAGCAGACTTACTAGGCCGATG -3'
(R):5'- AGCGTGTTCTGGTCCTCAAACAG -3'

Sequencing Primer
(F):5'- TAGGCCGATGATTCAACTGC -3'
(R):5'- GCCAGAAACTGAATTGCATTGC -3'

Posted On

2015-02-04