Incidental Mutation 'ANU23:Cse1l'
ID 262623
Institutional Source Beutler Lab
Gene Symbol Cse1l
Ensembl Gene ENSMUSG00000002718
Gene Name chromosome segregation 1 like
Synonyms Cas, Xpo2, Capts, 2610100P18Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # ANU23
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 166747961-166788309 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 166769428 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 278 (Y278*)
Ref Sequence ENSEMBL: ENSMUSP00000128376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]
AlphaFold Q9ERK4
Predicted Effect probably null
Transcript: ENSMUST00000002790
AA Change: Y278*
SMART Domains Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: Y278*

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 526 9.2e-169 PFAM
Pfam:CAS_CSE1 527 962 1.1e-181 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135139
Predicted Effect probably benign
Transcript: ENSMUST00000163437
SMART Domains Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
Pfam:Cse1 1 237 7.9e-105 PFAM
Pfam:CAS_CSE1 225 649 2.3e-195 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166871
Predicted Effect probably benign
Transcript: ENSMUST00000168599
SMART Domains Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 256 8.6e-40 PFAM
Pfam:Cse1 255 470 7.3e-99 PFAM
Pfam:CAS_CSE1 471 906 1.3e-201 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169290
AA Change: Y278*
SMART Domains Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718
AA Change: Y278*

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 389 5.2e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171410
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.2%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b G A 12: 70,215,822 (GRCm39) G88S probably damaging Het
Acot10 A G 15: 20,666,051 (GRCm39) F230S probably benign Het
Akap12 G T 10: 4,303,273 (GRCm39) A28S probably benign Het
Anks1 C A 17: 28,205,227 (GRCm39) T262K probably damaging Het
Arfgap3 A G 15: 83,197,710 (GRCm39) Y349H possibly damaging Het
Cacna1g G A 11: 94,357,054 (GRCm39) probably benign Het
Camsap2 T A 1: 136,225,528 (GRCm39) E199D probably benign Het
Ccdc13 A T 9: 121,656,429 (GRCm39) M128K probably benign Het
Ccdc38 T C 10: 93,405,797 (GRCm39) probably null Het
Cep95 G A 11: 106,704,641 (GRCm39) V499I probably benign Het
Cpne6 G C 14: 55,749,459 (GRCm39) M6I probably benign Het
Cpne6 A T 14: 55,752,706 (GRCm39) I299F probably damaging Het
Dip2c A G 13: 9,625,179 (GRCm39) N558D possibly damaging Het
Edar A T 10: 58,464,460 (GRCm39) C60S probably damaging Het
Fat2 T C 11: 55,201,698 (GRCm39) N459D probably benign Het
Fbxw8 C T 5: 118,251,785 (GRCm39) V243M possibly damaging Het
Fem1b G A 9: 62,704,810 (GRCm39) A150V possibly damaging Het
Gm5422 A T 10: 31,125,432 (GRCm39) noncoding transcript Het
Gpatch3 CAGGAGGAGGAGGAGGAG CAGGAGGAGGAGGAG 4: 133,305,613 (GRCm39) probably benign Het
Grin2c T C 11: 115,147,020 (GRCm39) T392A probably benign Het
Idh3a T A 9: 54,493,829 (GRCm39) probably null Het
Itpk1 T C 12: 102,572,362 (GRCm39) E117G probably damaging Het
Kif12 G T 4: 63,084,121 (GRCm39) P627Q probably damaging Het
Krtap15-1 T A 16: 88,626,255 (GRCm39) F88L probably benign Het
Mcm7 C T 5: 138,168,653 (GRCm39) V13I probably benign Het
Mlh1 T C 9: 111,081,980 (GRCm39) N248D possibly damaging Het
Or2i1 T C 17: 37,507,833 (GRCm39) N342S probably benign Het
Or4k15 A G 14: 50,364,039 (GRCm39) N2D probably benign Het
Or52z12 T C 7: 103,233,900 (GRCm39) Y224H probably damaging Het
Per2 T C 1: 91,376,555 (GRCm39) H106R probably damaging Het
Pfkl T A 10: 77,827,229 (GRCm39) T486S probably benign Het
Prkdc T C 16: 15,485,595 (GRCm39) V474A possibly damaging Het
Scamp4 C A 10: 80,445,256 (GRCm39) Q34K probably damaging Het
Serpinb3b A G 1: 107,082,395 (GRCm39) Y290H probably damaging Het
Sft2d2 G T 1: 165,011,564 (GRCm39) A110E probably benign Het
Siglecf T A 7: 43,001,377 (GRCm39) L115* probably null Het
Slc6a11 C T 6: 114,111,626 (GRCm39) T103M probably damaging Het
Slco1a1 T A 6: 141,892,313 (GRCm39) K18* probably null Het
Spata1 A T 3: 146,193,154 (GRCm39) Y112* probably null Het
Tbc1d32 G A 10: 56,056,620 (GRCm39) T440I probably benign Het
Vmn1r159 A G 7: 22,542,588 (GRCm39) V148A probably damaging Het
Wnt16 C T 6: 22,297,934 (GRCm39) R267C probably damaging Het
Xylt1 A C 7: 117,148,125 (GRCm39) S230R probably benign Het
Zfp334 T C 2: 165,223,017 (GRCm39) H342R probably damaging Het
Other mutations in Cse1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cse1l APN 2 166,769,724 (GRCm39) missense probably damaging 1.00
IGL01306:Cse1l APN 2 166,769,428 (GRCm39) nonsense probably null
IGL01672:Cse1l APN 2 166,771,887 (GRCm39) missense probably damaging 1.00
IGL02060:Cse1l APN 2 166,772,573 (GRCm39) missense probably damaging 1.00
IGL02897:Cse1l APN 2 166,761,628 (GRCm39) missense possibly damaging 0.47
IGL03375:Cse1l APN 2 166,784,977 (GRCm39) splice site probably benign
PIT4585001:Cse1l UTSW 2 166,783,394 (GRCm39) missense probably damaging 1.00
R0195:Cse1l UTSW 2 166,782,008 (GRCm39) missense probably benign
R1114:Cse1l UTSW 2 166,783,123 (GRCm39) splice site probably benign
R1539:Cse1l UTSW 2 166,768,292 (GRCm39) missense probably benign 0.00
R1721:Cse1l UTSW 2 166,768,331 (GRCm39) missense probably damaging 1.00
R1779:Cse1l UTSW 2 166,782,044 (GRCm39) splice site probably null
R1913:Cse1l UTSW 2 166,764,111 (GRCm39) missense probably damaging 1.00
R2069:Cse1l UTSW 2 166,783,412 (GRCm39) missense probably benign 0.01
R2398:Cse1l UTSW 2 166,770,917 (GRCm39) missense probably damaging 1.00
R4110:Cse1l UTSW 2 166,783,970 (GRCm39) missense probably benign 0.00
R4195:Cse1l UTSW 2 166,771,899 (GRCm39) missense probably damaging 1.00
R4603:Cse1l UTSW 2 166,786,452 (GRCm39) missense probably benign 0.09
R4686:Cse1l UTSW 2 166,774,080 (GRCm39) missense probably damaging 1.00
R4867:Cse1l UTSW 2 166,768,323 (GRCm39) missense possibly damaging 0.76
R4942:Cse1l UTSW 2 166,771,714 (GRCm39) missense probably damaging 1.00
R5164:Cse1l UTSW 2 166,786,348 (GRCm39) missense probably benign 0.02
R5475:Cse1l UTSW 2 166,783,174 (GRCm39) missense probably damaging 1.00
R5493:Cse1l UTSW 2 166,783,110 (GRCm39) intron probably benign
R5782:Cse1l UTSW 2 166,770,921 (GRCm39) missense probably damaging 1.00
R5862:Cse1l UTSW 2 166,757,127 (GRCm39) missense probably benign 0.00
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6913:Cse1l UTSW 2 166,771,797 (GRCm39) missense possibly damaging 0.65
R7683:Cse1l UTSW 2 166,764,708 (GRCm39) missense probably benign
R7871:Cse1l UTSW 2 166,777,591 (GRCm39) splice site probably null
R8001:Cse1l UTSW 2 166,781,833 (GRCm39) missense probably damaging 1.00
R8057:Cse1l UTSW 2 166,781,845 (GRCm39) missense probably damaging 1.00
R8175:Cse1l UTSW 2 166,785,128 (GRCm39) critical splice donor site probably null
R8347:Cse1l UTSW 2 166,769,505 (GRCm39) missense possibly damaging 0.95
R8386:Cse1l UTSW 2 166,761,604 (GRCm39) missense probably benign 0.00
R8479:Cse1l UTSW 2 166,763,893 (GRCm39) missense possibly damaging 0.95
R8973:Cse1l UTSW 2 166,785,000 (GRCm39) missense probably damaging 1.00
R9206:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9208:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9522:Cse1l UTSW 2 166,776,673 (GRCm39) missense probably benign
R9599:Cse1l UTSW 2 166,783,386 (GRCm39) missense probably benign
R9600:Cse1l UTSW 2 166,757,119 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAGCAGACTTACTAGGCCGATG -3'
(R):5'- AGCGTGTTCTGGTCCTCAAACAG -3'

Sequencing Primer
(F):5'- TAGGCCGATGATTCAACTGC -3'
(R):5'- GCCAGAAACTGAATTGCATTGC -3'
Posted On 2015-02-04