Incidental Mutation 'ANU23:Ccdc38'
ID262650
Institutional Source Beutler Lab
Gene Symbol Ccdc38
Ensembl Gene ENSMUSG00000036168
Gene Namecoiled-coil domain containing 38
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #ANU23
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location93540632-93584327 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 93569935 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092215] [ENSMUST00000132214]
Predicted Effect probably null
Transcript: ENSMUST00000092215
SMART Domains Protein: ENSMUSP00000089860
Gene: ENSMUSG00000036168

DomainStartEndE-ValueType
Pfam:DUF4200 112 230 4.4e-28 PFAM
low complexity region 280 289 N/A INTRINSIC
low complexity region 317 333 N/A INTRINSIC
coiled coil region 388 412 N/A INTRINSIC
coiled coil region 479 522 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128786
Predicted Effect probably null
Transcript: ENSMUST00000132214
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.2%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b G A 12: 70,169,048 G88S probably damaging Het
Acot10 A G 15: 20,665,965 F230S probably benign Het
Akap12 G T 10: 4,353,273 A28S probably benign Het
Anks1 C A 17: 27,986,253 T262K probably damaging Het
Arfgap3 A G 15: 83,313,509 Y349H possibly damaging Het
Cacna1g G A 11: 94,466,228 probably benign Het
Camsap2 T A 1: 136,297,790 E199D probably benign Het
Ccdc13 A T 9: 121,827,363 M128K probably benign Het
Cep95 G A 11: 106,813,815 V499I probably benign Het
Cpne6 G C 14: 55,512,002 M6I probably benign Het
Cpne6 A T 14: 55,515,249 I299F probably damaging Het
Cse1l T A 2: 166,927,508 Y278* probably null Het
Dip2c A G 13: 9,575,143 N558D possibly damaging Het
Edar A T 10: 58,628,638 C60S probably damaging Het
Fat2 T C 11: 55,310,872 N459D probably benign Het
Fbxw8 C T 5: 118,113,720 V243M possibly damaging Het
Fem1b G A 9: 62,797,528 A150V possibly damaging Het
Gm5422 A T 10: 31,249,436 noncoding transcript Het
Gpatch3 CAGGAGGAGGAGGAGGAG CAGGAGGAGGAGGAG 4: 133,578,302 probably benign Het
Grin2c T C 11: 115,256,194 T392A probably benign Het
Idh3a T A 9: 54,586,545 probably null Het
Itpk1 T C 12: 102,606,103 E117G probably damaging Het
Kif12 G T 4: 63,165,884 P627Q probably damaging Het
Krtap15 T A 16: 88,829,367 F88L probably benign Het
Mcm7 C T 5: 138,170,391 V13I probably benign Het
Mlh1 T C 9: 111,252,912 N248D possibly damaging Het
Olfr617 T C 7: 103,584,693 Y224H probably damaging Het
Olfr727 A G 14: 50,126,582 N2D probably benign Het
Olfr94 T C 17: 37,196,942 N342S probably benign Het
Per2 T C 1: 91,448,833 H106R probably damaging Het
Pfkl T A 10: 77,991,395 T486S probably benign Het
Prkdc T C 16: 15,667,731 V474A possibly damaging Het
Scamp4 C A 10: 80,609,422 Q34K probably damaging Het
Serpinb3b A G 1: 107,154,665 Y290H probably damaging Het
Sft2d2 G T 1: 165,183,995 A110E probably benign Het
Siglecf T A 7: 43,351,953 L115* probably null Het
Slc6a11 C T 6: 114,134,665 T103M probably damaging Het
Slco1a1 T A 6: 141,946,587 K18* probably null Het
Spata1 A T 3: 146,487,399 Y112* probably null Het
Tbc1d32 G A 10: 56,180,524 T440I probably benign Het
Vmn1r159 A G 7: 22,843,163 V148A probably damaging Het
Wnt16 C T 6: 22,297,935 R267C probably damaging Het
Xylt1 A C 7: 117,548,890 S230R probably benign Het
Zfp334 T C 2: 165,381,097 H342R probably damaging Het
Other mutations in Ccdc38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Ccdc38 APN 10 93569935 critical splice donor site probably null
IGL01986:Ccdc38 APN 10 93579843 missense probably damaging 1.00
IGL02396:Ccdc38 APN 10 93574132 missense possibly damaging 0.61
IGL02568:Ccdc38 APN 10 93579823 missense probably damaging 1.00
R0004:Ccdc38 UTSW 10 93574102 missense probably damaging 1.00
R0194:Ccdc38 UTSW 10 93565912 nonsense probably null
R0371:Ccdc38 UTSW 10 93562812 nonsense probably null
R1374:Ccdc38 UTSW 10 93582434 splice site probably benign
R1388:Ccdc38 UTSW 10 93581840 splice site probably benign
R1546:Ccdc38 UTSW 10 93565879 missense probably benign 0.01
R2377:Ccdc38 UTSW 10 93574035 missense probably damaging 1.00
R2419:Ccdc38 UTSW 10 93548975 missense probably benign 0.23
R3949:Ccdc38 UTSW 10 93550219 missense probably damaging 1.00
R5592:Ccdc38 UTSW 10 93550202 missense possibly damaging 0.58
R5652:Ccdc38 UTSW 10 93555586 splice site probably null
R5857:Ccdc38 UTSW 10 93562833 missense possibly damaging 0.67
R5918:Ccdc38 UTSW 10 93570886 nonsense probably null
R5919:Ccdc38 UTSW 10 93578838 missense possibly damaging 0.95
R6057:Ccdc38 UTSW 10 93581746 missense probably damaging 1.00
R6293:Ccdc38 UTSW 10 93562797 nonsense probably null
R7511:Ccdc38 UTSW 10 93562800 missense possibly damaging 0.92
R8006:Ccdc38 UTSW 10 93555586 splice site probably null
R8206:Ccdc38 UTSW 10 93563284 missense probably damaging 0.97
R8313:Ccdc38 UTSW 10 93563249 missense probably damaging 1.00
Z1177:Ccdc38 UTSW 10 93562876 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGCGTCCAATTTCAGTGGAATG -3'
(R):5'- TGCACAGGCTATAGGAACAGCTAGG -3'

Sequencing Primer
(F):5'- CGTCCAATTTCAGTGGAATGAAAGG -3'
(R):5'- GTAGTGGGTCCTTATAAAGAGAGC -3'
Posted On2015-02-04