Incidental Mutation 'ANU23:Itpk1'
ID262656
Institutional Source Beutler Lab
Gene Symbol Itpk1
Ensembl Gene ENSMUSG00000057963
Gene Nameinositol 1,3,4-triphosphate 5/6 kinase
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #ANU23
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location102568582-102704930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102606103 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 117 (E117G)
Ref Sequence ENSEMBL: ENSMUSP00000046027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046518] [ENSMUST00000179210] [ENSMUST00000191320]
Predicted Effect probably damaging
Transcript: ENSMUST00000046518
AA Change: E117G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046027
Gene: ENSMUSG00000057963
AA Change: E117G

DomainStartEndE-ValueType
Pfam:Ins134_P3_kin 1 318 2.8e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179210
Predicted Effect probably benign
Transcript: ENSMUST00000191320
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.2%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the inositol 1,3,4-trisphosphate 5/6-kinase family. This enzyme regulates the synthesis of inositol tetraphosphate, and downstream products, inositol pentakisphosphate and inositol hexakisphosphate. Inositol metabolism plays a role in the development of the neural tube. Disruptions in this gene are thought to be associated with neural tube defects. A pseudogene of this gene has been identified on chromosome X. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mice homozygous for a gene trap allele exhibit neural tube defects (exencephaly and spina bifida), growth retardation, kyphoscoliosis, and rib formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b G A 12: 70,169,048 G88S probably damaging Het
Acot10 A G 15: 20,665,965 F230S probably benign Het
Akap12 G T 10: 4,353,273 A28S probably benign Het
Anks1 C A 17: 27,986,253 T262K probably damaging Het
Arfgap3 A G 15: 83,313,509 Y349H possibly damaging Het
Cacna1g G A 11: 94,466,228 probably benign Het
Camsap2 T A 1: 136,297,790 E199D probably benign Het
Ccdc13 A T 9: 121,827,363 M128K probably benign Het
Ccdc38 T C 10: 93,569,935 probably null Het
Cep95 G A 11: 106,813,815 V499I probably benign Het
Cpne6 G C 14: 55,512,002 M6I probably benign Het
Cpne6 A T 14: 55,515,249 I299F probably damaging Het
Cse1l T A 2: 166,927,508 Y278* probably null Het
Dip2c A G 13: 9,575,143 N558D possibly damaging Het
Edar A T 10: 58,628,638 C60S probably damaging Het
Fat2 T C 11: 55,310,872 N459D probably benign Het
Fbxw8 C T 5: 118,113,720 V243M possibly damaging Het
Fem1b G A 9: 62,797,528 A150V possibly damaging Het
Gm5422 A T 10: 31,249,436 noncoding transcript Het
Gpatch3 CAGGAGGAGGAGGAGGAG CAGGAGGAGGAGGAG 4: 133,578,302 probably benign Het
Grin2c T C 11: 115,256,194 T392A probably benign Het
Idh3a T A 9: 54,586,545 probably null Het
Kif12 G T 4: 63,165,884 P627Q probably damaging Het
Krtap15 T A 16: 88,829,367 F88L probably benign Het
Mcm7 C T 5: 138,170,391 V13I probably benign Het
Mlh1 T C 9: 111,252,912 N248D possibly damaging Het
Olfr617 T C 7: 103,584,693 Y224H probably damaging Het
Olfr727 A G 14: 50,126,582 N2D probably benign Het
Olfr94 T C 17: 37,196,942 N342S probably benign Het
Per2 T C 1: 91,448,833 H106R probably damaging Het
Pfkl T A 10: 77,991,395 T486S probably benign Het
Prkdc T C 16: 15,667,731 V474A possibly damaging Het
Scamp4 C A 10: 80,609,422 Q34K probably damaging Het
Serpinb3b A G 1: 107,154,665 Y290H probably damaging Het
Sft2d2 G T 1: 165,183,995 A110E probably benign Het
Siglecf T A 7: 43,351,953 L115* probably null Het
Slc6a11 C T 6: 114,134,665 T103M probably damaging Het
Slco1a1 T A 6: 141,946,587 K18* probably null Het
Spata1 A T 3: 146,487,399 Y112* probably null Het
Tbc1d32 G A 10: 56,180,524 T440I probably benign Het
Vmn1r159 A G 7: 22,843,163 V148A probably damaging Het
Wnt16 C T 6: 22,297,935 R267C probably damaging Het
Xylt1 A C 7: 117,548,890 S230R probably benign Het
Zfp334 T C 2: 165,381,097 H342R probably damaging Het
Other mutations in Itpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Itpk1 APN 12 102606103 missense probably damaging 1.00
IGL02247:Itpk1 APN 12 102623409 missense probably damaging 1.00
IGL02998:Itpk1 APN 12 102579139 missense probably damaging 1.00
R0432:Itpk1 UTSW 12 102606078 splice site probably benign
R0622:Itpk1 UTSW 12 102573980 missense probably damaging 1.00
R0659:Itpk1 UTSW 12 102606078 splice site probably benign
R0835:Itpk1 UTSW 12 102675448 missense probably damaging 1.00
R1171:Itpk1 UTSW 12 102606119 missense probably damaging 1.00
R1812:Itpk1 UTSW 12 102574058 missense probably benign 0.01
R1968:Itpk1 UTSW 12 102675470 splice site probably null
R2277:Itpk1 UTSW 12 102570260 missense probably benign
R2926:Itpk1 UTSW 12 102579130 missense probably damaging 1.00
R4584:Itpk1 UTSW 12 102570157 missense possibly damaging 0.89
R4690:Itpk1 UTSW 12 102606175 missense probably damaging 0.96
R5050:Itpk1 UTSW 12 102704810 missense probably damaging 1.00
R5326:Itpk1 UTSW 12 102573966 missense possibly damaging 0.49
R5801:Itpk1 UTSW 12 102573945 missense probably damaging 1.00
R5945:Itpk1 UTSW 12 102588553 missense probably damaging 0.97
R7262:Itpk1 UTSW 12 102675453 missense possibly damaging 0.89
R7421:Itpk1 UTSW 12 102574065 missense possibly damaging 0.92
R7883:Itpk1 UTSW 12 102606175 missense probably benign 0.35
R8438:Itpk1 UTSW 12 102606159 start gained probably benign
X0058:Itpk1 UTSW 12 102574024 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGCCAGAATAGCTCTCCTCAAAG -3'
(R):5'- AATGCCCTTGTCACAGCATAGCC -3'

Sequencing Primer
(F):5'- CAAAGCATCCTCTGGCTTATG -3'
(R):5'- GTCACAGCATAGCCCCCTC -3'
Posted On2015-02-04