Incidental Mutation 'ANU74:Hecw2'
ID262669
Institutional Source Beutler Lab
Gene Symbol Hecw2
Ensembl Gene ENSMUSG00000042807
Gene NameHECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
SynonymsA730039N16Rik, Nedl2, D030049F17Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.545) question?
Stock #ANU74
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location53806876-54195168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53925694 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 658 (T658A)
Ref Sequence ENSEMBL: ENSMUSP00000113283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087659] [ENSMUST00000120904]
Predicted Effect probably benign
Transcript: ENSMUST00000087659
AA Change: T658A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000084942
Gene: ENSMUSG00000042807
AA Change: T658A

DomainStartEndE-ValueType
Pfam:HECW_N 45 164 4.6e-62 PFAM
low complexity region 165 178 N/A INTRINSIC
C2 186 297 2.19e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 746 755 N/A INTRINSIC
low complexity region 769 786 N/A INTRINSIC
WW 814 846 1.21e-11 SMART
coiled coil region 853 880 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
WW 992 1024 2.12e-7 SMART
Blast:HECTc 1111 1183 2e-23 BLAST
HECTc 1241 1578 8.02e-183 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120904
AA Change: T658A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113283
Gene: ENSMUSG00000042807
AA Change: T658A

DomainStartEndE-ValueType
PDB:2LFE|A 42 162 6e-80 PDB
low complexity region 165 178 N/A INTRINSIC
C2 186 297 2.19e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 746 755 N/A INTRINSIC
low complexity region 769 786 N/A INTRINSIC
WW 814 846 1.21e-11 SMART
coiled coil region 853 880 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
WW 992 1024 2.12e-7 SMART
Blast:HECTc 1111 1183 2e-23 BLAST
HECTc 1241 1578 8.02e-183 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of E3 ubiquitin ligases which plays an important role in the proliferation, migration and differentiation of neural crest cells as a regulator of glial cell line-derived neurotrophic factor (GDNF)/Ret signaling. This gene also plays an important role in angiogenesis through stabilization of endothelial cell-to-cell junctions as a regulator of angiomotin-like 1 stability. The encoded protein contains an N-terminal calcium/lipid-binding (C2) domain involved in membrane targeting, two-four WW domains responsible for cellular localization and substrate recognition, and a C-terminal homologous with E6-associated protein C-terminus (HECT) catalytic domain. Naturally occurring mutations in this gene are associated with neurodevelopmental delay, hypotonia, and epilepsy. The decreased expression of this gene in the aganglionic colon is associated with Hirschsprung's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 G A 5: 49,961,038 S1056L probably benign Het
Ankrd26 A T 6: 118,552,775 D236E probably benign Het
Capn15 C T 17: 25,965,486 W7* probably null Het
Celsr2 G A 3: 108,412,499 T999M probably damaging Het
Chrd T A 16: 20,741,319 M912K possibly damaging Het
Col9a1 A G 1: 24,185,328 D197G unknown Het
Csf1r A G 18: 61,117,391 E431G probably benign Het
Eloc A G 1: 16,643,350 F115L possibly damaging Het
Fap T C 2: 62,547,769 D193G probably damaging Het
Fscn2 T C 11: 120,362,336 Y210H probably damaging Het
Fut9 G C 4: 25,620,802 T4R probably benign Het
Grb2 A T 11: 115,645,907 D131E probably benign Het
Helz2 T C 2: 181,234,834 E1289G probably benign Het
Hyou1 A G 9: 44,381,263 N92D possibly damaging Het
Irf8 A C 8: 120,739,869 I18L possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kif12 GC "GCCTCCACCCGGCGGTC,GCC" 4: 63,171,426 probably null Het
Lamc2 A C 1: 153,131,835 D864E probably benign Het
Map3k4 A G 17: 12,232,976 V1475A probably damaging Het
Mapk8ip3 A C 17: 24,900,577 M1030R possibly damaging Het
Mat1a A G 14: 41,111,142 D94G probably benign Het
Myh15 T A 16: 49,172,932 D1643E possibly damaging Het
Myo15b T C 11: 115,878,413 F55L probably damaging Het
Nhlh2 A T 3: 102,012,654 M1L probably benign Het
Nup214 T C 2: 32,034,966 S1836P probably damaging Het
Olfr1034 T A 2: 86,047,311 Y276* probably null Het
Olr1 G A 6: 129,500,069 R78C possibly damaging Het
Pam16 C A 16: 4,616,633 V98F probably damaging Het
Pelp1 C T 11: 70,395,087 V652I probably damaging Het
Pole A G 5: 110,289,370 H67R probably benign Het
Rbms1 G T 2: 60,797,716 A60E probably damaging Het
Recql4 A T 15: 76,705,757 M789K possibly damaging Het
Rrn3 T C 16: 13,811,533 F571S possibly damaging Het
Ryr3 T C 2: 112,831,230 probably null Het
Sec61b C A 4: 47,474,922 N26K possibly damaging Het
Serinc1 T C 10: 57,519,842 E284G probably benign Het
Slc30a9 G A 5: 67,349,852 D496N probably damaging Het
Slc44a4 G A 17: 34,921,578 R249H probably damaging Het
Slc6a13 A C 6: 121,334,876 D404A probably benign Het
Spata18 A G 5: 73,671,113 E225G probably damaging Het
Sspo G A 6: 48,460,959 G1351S probably damaging Het
Tgm3 T C 2: 130,048,390 V691A probably damaging Het
Tns3 C T 11: 8,492,149 R738Q probably benign Het
Tyk2 A T 9: 21,116,158 I506N probably damaging Het
Ube2v1 G A 2: 167,610,344 T113I probably damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn2r14 A T 5: 109,219,044 S437T probably benign Het
Vmn2r78 G C 7: 86,921,065 V264L possibly damaging Het
Zfp956 T G 6: 47,963,573 Y289D probably benign Het
Other mutations in Hecw2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Hecw2 APN 1 53830737 missense probably damaging 1.00
IGL00338:Hecw2 APN 1 53827881 splice site probably benign
IGL00530:Hecw2 APN 1 53853280 missense probably damaging 1.00
IGL01343:Hecw2 APN 1 53826976 missense probably damaging 0.96
IGL01503:Hecw2 APN 1 53826961 missense probably damaging 1.00
IGL01989:Hecw2 APN 1 53840792 missense probably damaging 1.00
IGL02016:Hecw2 APN 1 53831543 missense possibly damaging 0.73
IGL02052:Hecw2 APN 1 53926511 missense probably benign
IGL02085:Hecw2 APN 1 53942802 critical splice acceptor site probably null
IGL02302:Hecw2 APN 1 53933248 missense probably damaging 1.00
IGL02310:Hecw2 APN 1 53923916 missense probably null 0.38
IGL02388:Hecw2 APN 1 53925699 missense probably benign 0.17
IGL02499:Hecw2 APN 1 53926488 missense probably benign
IGL02695:Hecw2 APN 1 53926209 missense possibly damaging 0.94
IGL02732:Hecw2 APN 1 53926688 splice site probably benign
IGL03100:Hecw2 APN 1 53831656 missense probably damaging 1.00
IGL03175:Hecw2 APN 1 53926257 missense possibly damaging 0.51
IGL03253:Hecw2 APN 1 53832716 missense possibly damaging 0.85
IGL03356:Hecw2 APN 1 53927058 splice site probably benign
Memoriam UTSW 1 53926056 missense probably benign
recollect UTSW 1 53904422 missense possibly damaging 0.88
R0077:Hecw2 UTSW 1 53868831 splice site probably benign
R0133:Hecw2 UTSW 1 53830740 missense probably damaging 1.00
R0268:Hecw2 UTSW 1 53926698 splice site probably benign
R1303:Hecw2 UTSW 1 54040393 missense probably benign 0.00
R1460:Hecw2 UTSW 1 53813245 missense probably damaging 0.96
R1524:Hecw2 UTSW 1 53851618 missense probably damaging 1.00
R1533:Hecw2 UTSW 1 53926545 splice site probably null
R1828:Hecw2 UTSW 1 53926023 missense probably benign
R2170:Hecw2 UTSW 1 53942797 missense probably damaging 0.99
R2338:Hecw2 UTSW 1 53904422 missense possibly damaging 0.88
R3016:Hecw2 UTSW 1 53830680 missense probably damaging 1.00
R3872:Hecw2 UTSW 1 53832757 splice site probably benign
R3892:Hecw2 UTSW 1 53926121 missense probably benign 0.01
R4086:Hecw2 UTSW 1 53831656 missense probably damaging 1.00
R4247:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4248:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4249:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4545:Hecw2 UTSW 1 53813222 makesense probably null
R4805:Hecw2 UTSW 1 53840859 missense probably damaging 1.00
R4834:Hecw2 UTSW 1 53830752 missense probably damaging 1.00
R4884:Hecw2 UTSW 1 53950841 missense probably benign 0.03
R4983:Hecw2 UTSW 1 53832671 missense probably benign 0.42
R5168:Hecw2 UTSW 1 53913300 missense probably damaging 1.00
R5482:Hecw2 UTSW 1 53926201 missense probably benign 0.09
R5549:Hecw2 UTSW 1 53925691 missense possibly damaging 0.91
R5623:Hecw2 UTSW 1 53832623 missense probably null 1.00
R5740:Hecw2 UTSW 1 53887603 missense probably benign 0.12
R5919:Hecw2 UTSW 1 53937090 missense probably damaging 0.99
R6058:Hecw2 UTSW 1 53923976 missense possibly damaging 0.67
R6460:Hecw2 UTSW 1 53868833 splice site probably null
R6875:Hecw2 UTSW 1 53937132 missense probably benign 0.01
R7097:Hecw2 UTSW 1 53865124 missense possibly damaging 0.88
R7131:Hecw2 UTSW 1 53865121 missense probably damaging 1.00
R7291:Hecw2 UTSW 1 53914594 missense probably damaging 1.00
R7401:Hecw2 UTSW 1 53904343 missense probably damaging 1.00
R7482:Hecw2 UTSW 1 54040470 missense probably damaging 0.99
R7501:Hecw2 UTSW 1 53913872 critical splice acceptor site probably null
R7520:Hecw2 UTSW 1 53926056 missense probably benign
R7611:Hecw2 UTSW 1 53913300 missense probably damaging 1.00
R8184:Hecw2 UTSW 1 54040387 missense probably benign 0.37
R8286:Hecw2 UTSW 1 53840769 missense probably damaging 1.00
R8300:Hecw2 UTSW 1 53887616 missense probably null 0.07
R8362:Hecw2 UTSW 1 54040491 start codon destroyed probably null 0.51
Z1177:Hecw2 UTSW 1 53923943 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCAGATAAAGCAGCAGCTTCAGCC -3'
(R):5'- TAGATCAGCCCACAAGTGGTGCAG -3'

Sequencing Primer
(F):5'- CAGCTTCAGCCGCTGAC -3'
(R):5'- CTTCTGACACATCTGGAGGG -3'
Posted On2015-02-04