Incidental Mutation 'ANU74:Helz2'
ID 262681
Institutional Source Beutler Lab
Gene Symbol Helz2
Ensembl Gene ENSMUSG00000027580
Gene Name helicase with zinc finger 2, transcriptional coactivator
Synonyms BC006779
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # ANU74
Quality Score 217
Status Not validated
Chromosome 2
Chromosomal Location 180869408-180883820 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 180876627 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1289 (E1289G)
Ref Sequence ENSEMBL: ENSMUSP00000112917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094203] [ENSMUST00000108831] [ENSMUST00000121484]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000094203
AA Change: E1289G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000091756
Gene: ENSMUSG00000027580
AA Change: E1289G

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108831
AA Change: E1289G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104459
Gene: ENSMUSG00000027580
AA Change: E1289G

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121484
AA Change: E1289G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112917
Gene: ENSMUSG00000027580
AA Change: E1289G

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
Pfam:AAA_11 761 877 3.9e-10 PFAM
Pfam:AAA_19 780 849 1.7e-7 PFAM
Pfam:AAA_11 870 952 2e-15 PFAM
Pfam:AAA_12 958 1162 3.8e-26 PFAM
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
Pfam:AAA_11 2400 2653 4e-42 PFAM
Pfam:AAA_12 2660 2866 2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155049
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear transcriptional co-activator for peroxisome proliferator activated receptor alpha. The encoded protein contains a zinc finger and is a helicase that appears to be part of the peroxisome proliferator activated receptor alpha interacting complex. This gene is a member of the DNA2/NAM7 helicase gene family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slower weight gain, hyperleptinemia, increased oxygen consumption, decreased respiratory quotient, decreased liver triglyceride level and ameliorated hyperlipidemia and hepatosteatosis when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 G A 5: 50,118,380 (GRCm39) S1056L probably benign Het
Ankrd26 A T 6: 118,529,736 (GRCm39) D236E probably benign Het
Capn15 C T 17: 26,184,460 (GRCm39) W7* probably null Het
Celsr2 G A 3: 108,319,815 (GRCm39) T999M probably damaging Het
Chrd T A 16: 20,560,069 (GRCm39) M912K possibly damaging Het
Col9a1 A G 1: 24,224,409 (GRCm39) D197G unknown Het
Csf1r A G 18: 61,250,463 (GRCm39) E431G probably benign Het
Eloc A G 1: 16,713,574 (GRCm39) F115L possibly damaging Het
Fap T C 2: 62,378,113 (GRCm39) D193G probably damaging Het
Fscn2 T C 11: 120,253,162 (GRCm39) Y210H probably damaging Het
Fut9 G C 4: 25,620,802 (GRCm39) T4R probably benign Het
Grb2 A T 11: 115,536,733 (GRCm39) D131E probably benign Het
Hecw2 T C 1: 53,964,853 (GRCm39) T658A probably benign Het
Hyou1 A G 9: 44,292,560 (GRCm39) N92D possibly damaging Het
Irf8 A C 8: 121,466,608 (GRCm39) I18L possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,089,660 (GRCm39) probably benign Het
Kif12 GC "GCCTCCACCCGGCGGTC,GCC" 4: 63,089,663 (GRCm39) probably null Het
Lamc2 A C 1: 153,007,581 (GRCm39) D864E probably benign Het
Map3k4 A G 17: 12,451,863 (GRCm39) V1475A probably damaging Het
Mapk8ip3 A C 17: 25,119,551 (GRCm39) M1030R possibly damaging Het
Mat1a A G 14: 40,833,099 (GRCm39) D94G probably benign Het
Myh15 T A 16: 48,993,295 (GRCm39) D1643E possibly damaging Het
Myo15b T C 11: 115,769,239 (GRCm39) F55L probably damaging Het
Nhlh2 A T 3: 101,919,970 (GRCm39) M1L probably benign Het
Nup214 T C 2: 31,924,978 (GRCm39) S1836P probably damaging Het
Olr1 G A 6: 129,477,032 (GRCm39) R78C possibly damaging Het
Or5m9 T A 2: 85,877,655 (GRCm39) Y276* probably null Het
Pam16 C A 16: 4,434,497 (GRCm39) V98F probably damaging Het
Pelp1 C T 11: 70,285,913 (GRCm39) V652I probably damaging Het
Pole A G 5: 110,437,236 (GRCm39) H67R probably benign Het
Rbms1 G T 2: 60,628,060 (GRCm39) A60E probably damaging Het
Recql4 A T 15: 76,589,957 (GRCm39) M789K possibly damaging Het
Rrn3 T C 16: 13,629,397 (GRCm39) F571S possibly damaging Het
Ryr3 T C 2: 112,661,575 (GRCm39) probably null Het
Sec61b C A 4: 47,474,922 (GRCm39) N26K possibly damaging Het
Serinc1 T C 10: 57,395,938 (GRCm39) E284G probably benign Het
Slc30a9 G A 5: 67,507,195 (GRCm39) D496N probably damaging Het
Slc44a4 G A 17: 35,140,554 (GRCm39) R249H probably damaging Het
Slc6a13 A C 6: 121,311,835 (GRCm39) D404A probably benign Het
Spata18 A G 5: 73,828,456 (GRCm39) E225G probably damaging Het
Sspo G A 6: 48,437,893 (GRCm39) G1351S probably damaging Het
Tgm3 T C 2: 129,890,310 (GRCm39) V691A probably damaging Het
Tns3 C T 11: 8,442,149 (GRCm39) R738Q probably benign Het
Tyk2 A T 9: 21,027,454 (GRCm39) I506N probably damaging Het
Ube2v1 G A 2: 167,452,264 (GRCm39) T113I probably damaging Het
Vmn1r177 A G 7: 23,565,645 (GRCm39) V77A possibly damaging Het
Vmn2r14 A T 5: 109,366,910 (GRCm39) S437T probably benign Het
Vmn2r78 G C 7: 86,570,273 (GRCm39) V264L possibly damaging Het
Zfp956 T G 6: 47,940,507 (GRCm39) Y289D probably benign Het
Other mutations in Helz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Helz2 APN 2 180,871,495 (GRCm39) missense probably damaging 1.00
IGL00515:Helz2 APN 2 180,874,799 (GRCm39) nonsense probably null
IGL00704:Helz2 APN 2 180,876,178 (GRCm39) missense probably damaging 1.00
IGL00847:Helz2 APN 2 180,874,038 (GRCm39) missense possibly damaging 0.73
IGL01448:Helz2 APN 2 180,875,770 (GRCm39) missense probably damaging 1.00
IGL01783:Helz2 APN 2 180,874,674 (GRCm39) missense probably damaging 1.00
IGL01790:Helz2 APN 2 180,880,274 (GRCm39) missense probably benign 0.29
IGL02116:Helz2 APN 2 180,873,978 (GRCm39) missense probably damaging 1.00
IGL02226:Helz2 APN 2 180,873,483 (GRCm39) missense probably damaging 1.00
IGL02402:Helz2 APN 2 180,872,704 (GRCm39) missense probably damaging 1.00
IGL02403:Helz2 APN 2 180,872,815 (GRCm39) missense probably damaging 1.00
IGL02733:Helz2 APN 2 180,876,819 (GRCm39) missense probably benign 0.14
IGL02869:Helz2 APN 2 180,872,939 (GRCm39) intron probably benign
IGL03003:Helz2 APN 2 180,882,046 (GRCm39) missense probably damaging 1.00
IGL03060:Helz2 APN 2 180,871,015 (GRCm39) critical splice donor site probably null
IGL03310:Helz2 APN 2 180,873,597 (GRCm39) missense probably benign 0.00
Colby UTSW 2 180,874,995 (GRCm39) missense probably damaging 1.00
R0013:Helz2 UTSW 2 180,882,752 (GRCm39) missense probably benign
R0013:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0014:Helz2 UTSW 2 180,882,304 (GRCm39) missense probably damaging 1.00
R0014:Helz2 UTSW 2 180,882,304 (GRCm39) missense probably damaging 1.00
R0016:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0018:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0019:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0019:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0055:Helz2 UTSW 2 180,870,614 (GRCm39) missense possibly damaging 0.47
R0055:Helz2 UTSW 2 180,870,614 (GRCm39) missense possibly damaging 0.47
R0071:Helz2 UTSW 2 180,878,200 (GRCm39) missense probably damaging 1.00
R0071:Helz2 UTSW 2 180,878,200 (GRCm39) missense probably damaging 1.00
R0111:Helz2 UTSW 2 180,879,595 (GRCm39) missense probably benign 0.30
R0117:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0135:Helz2 UTSW 2 180,874,062 (GRCm39) missense probably damaging 1.00
R0194:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0242:Helz2 UTSW 2 180,872,223 (GRCm39) missense probably damaging 1.00
R0242:Helz2 UTSW 2 180,872,223 (GRCm39) missense probably damaging 1.00
R0254:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0410:Helz2 UTSW 2 180,872,386 (GRCm39) missense probably damaging 1.00
R0442:Helz2 UTSW 2 180,874,002 (GRCm39) missense probably damaging 0.97
R0497:Helz2 UTSW 2 180,871,449 (GRCm39) missense probably damaging 0.97
R0517:Helz2 UTSW 2 180,869,563 (GRCm39) missense probably benign 0.00
R0541:Helz2 UTSW 2 180,876,618 (GRCm39) missense possibly damaging 0.89
R0542:Helz2 UTSW 2 180,873,882 (GRCm39) missense probably damaging 1.00
R0591:Helz2 UTSW 2 180,873,909 (GRCm39) missense probably damaging 0.96
R0692:Helz2 UTSW 2 180,882,674 (GRCm39) missense probably benign
R0826:Helz2 UTSW 2 180,882,646 (GRCm39) missense possibly damaging 0.51
R0834:Helz2 UTSW 2 180,872,570 (GRCm39) missense probably damaging 1.00
R0880:Helz2 UTSW 2 180,877,928 (GRCm39) missense probably benign
R1170:Helz2 UTSW 2 180,871,608 (GRCm39) missense probably damaging 1.00
R1186:Helz2 UTSW 2 180,872,921 (GRCm39) missense probably damaging 1.00
R1344:Helz2 UTSW 2 180,879,389 (GRCm39) missense possibly damaging 0.89
R1358:Helz2 UTSW 2 180,874,774 (GRCm39) missense probably damaging 1.00
R1436:Helz2 UTSW 2 180,877,317 (GRCm39) missense probably damaging 0.99
R1464:Helz2 UTSW 2 180,881,447 (GRCm39) missense probably damaging 1.00
R1464:Helz2 UTSW 2 180,881,447 (GRCm39) missense probably damaging 1.00
R1466:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1466:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1477:Helz2 UTSW 2 180,874,597 (GRCm39) missense probably benign 0.00
R1564:Helz2 UTSW 2 180,875,021 (GRCm39) missense probably benign 0.01
R1584:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1655:Helz2 UTSW 2 180,875,940 (GRCm39) missense probably damaging 0.99
R1757:Helz2 UTSW 2 180,878,056 (GRCm39) missense probably damaging 1.00
R1779:Helz2 UTSW 2 180,880,252 (GRCm39) missense possibly damaging 0.84
R1779:Helz2 UTSW 2 180,876,780 (GRCm39) missense probably benign
R1837:Helz2 UTSW 2 180,871,082 (GRCm39) missense probably damaging 1.00
R1845:Helz2 UTSW 2 180,873,878 (GRCm39) missense probably benign 0.02
R1894:Helz2 UTSW 2 180,876,082 (GRCm39) missense probably damaging 1.00
R1913:Helz2 UTSW 2 180,875,543 (GRCm39) missense probably damaging 1.00
R2005:Helz2 UTSW 2 180,873,122 (GRCm39) missense probably benign 0.45
R2034:Helz2 UTSW 2 180,874,371 (GRCm39) missense probably damaging 1.00
R2036:Helz2 UTSW 2 180,879,272 (GRCm39) missense probably benign 0.03
R2061:Helz2 UTSW 2 180,882,337 (GRCm39) missense probably damaging 1.00
R2088:Helz2 UTSW 2 180,876,895 (GRCm39) missense probably benign 0.07
R2142:Helz2 UTSW 2 180,873,173 (GRCm39) missense probably benign
R2180:Helz2 UTSW 2 180,875,525 (GRCm39) missense probably damaging 1.00
R2192:Helz2 UTSW 2 180,870,841 (GRCm39) nonsense probably null
R2248:Helz2 UTSW 2 180,875,226 (GRCm39) missense probably benign 0.33
R2495:Helz2 UTSW 2 180,874,705 (GRCm39) missense probably damaging 0.99
R2886:Helz2 UTSW 2 180,882,535 (GRCm39) missense probably benign
R3617:Helz2 UTSW 2 180,874,854 (GRCm39) missense probably damaging 1.00
R3776:Helz2 UTSW 2 180,882,182 (GRCm39) nonsense probably null
R3803:Helz2 UTSW 2 180,881,789 (GRCm39) missense probably damaging 0.96
R4043:Helz2 UTSW 2 180,871,503 (GRCm39) missense probably benign 0.00
R4052:Helz2 UTSW 2 180,882,268 (GRCm39) missense probably damaging 1.00
R4232:Helz2 UTSW 2 180,871,695 (GRCm39) missense probably damaging 1.00
R4521:Helz2 UTSW 2 180,870,626 (GRCm39) missense probably benign
R4624:Helz2 UTSW 2 180,881,101 (GRCm39) missense probably damaging 0.99
R4720:Helz2 UTSW 2 180,880,210 (GRCm39) missense probably damaging 1.00
R4831:Helz2 UTSW 2 180,879,210 (GRCm39) missense probably damaging 1.00
R4852:Helz2 UTSW 2 180,871,913 (GRCm39) missense probably damaging 1.00
R4894:Helz2 UTSW 2 180,877,940 (GRCm39) missense probably benign 0.01
R4915:Helz2 UTSW 2 180,874,231 (GRCm39) missense possibly damaging 0.80
R4965:Helz2 UTSW 2 180,882,709 (GRCm39) missense possibly damaging 0.79
R5022:Helz2 UTSW 2 180,882,362 (GRCm39) missense probably benign
R5089:Helz2 UTSW 2 180,876,942 (GRCm39) missense probably benign 0.14
R5190:Helz2 UTSW 2 180,872,550 (GRCm39) critical splice donor site probably null
R5309:Helz2 UTSW 2 180,876,639 (GRCm39) missense probably benign 0.08
R5358:Helz2 UTSW 2 180,877,321 (GRCm39) missense probably damaging 1.00
R5379:Helz2 UTSW 2 180,876,862 (GRCm39) missense probably benign
R5559:Helz2 UTSW 2 180,871,919 (GRCm39) missense probably damaging 0.98
R5591:Helz2 UTSW 2 180,882,051 (GRCm39) missense probably damaging 0.99
R5596:Helz2 UTSW 2 180,879,082 (GRCm39) intron probably benign
R5805:Helz2 UTSW 2 180,882,301 (GRCm39) missense probably damaging 1.00
R5823:Helz2 UTSW 2 180,878,189 (GRCm39) missense possibly damaging 0.92
R5825:Helz2 UTSW 2 180,874,449 (GRCm39) missense probably benign 0.02
R5873:Helz2 UTSW 2 180,875,821 (GRCm39) missense possibly damaging 0.78
R5928:Helz2 UTSW 2 180,872,177 (GRCm39) missense possibly damaging 0.82
R5936:Helz2 UTSW 2 180,872,560 (GRCm39) missense probably damaging 1.00
R5975:Helz2 UTSW 2 180,872,843 (GRCm39) missense probably benign 0.08
R6045:Helz2 UTSW 2 180,882,106 (GRCm39) missense probably benign 0.03
R6077:Helz2 UTSW 2 180,874,831 (GRCm39) missense probably benign 0.41
R6218:Helz2 UTSW 2 180,874,087 (GRCm39) missense probably benign 0.03
R6218:Helz2 UTSW 2 180,877,738 (GRCm39) missense probably damaging 1.00
R6315:Helz2 UTSW 2 180,874,995 (GRCm39) missense probably damaging 1.00
R6346:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6371:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6372:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6373:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6385:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6464:Helz2 UTSW 2 180,876,862 (GRCm39) missense probably benign
R6581:Helz2 UTSW 2 180,871,172 (GRCm39) missense probably damaging 0.99
R6651:Helz2 UTSW 2 180,881,350 (GRCm39) nonsense probably null
R6964:Helz2 UTSW 2 180,872,221 (GRCm39) missense probably damaging 1.00
R7061:Helz2 UTSW 2 180,882,307 (GRCm39) missense probably damaging 1.00
R7153:Helz2 UTSW 2 180,873,078 (GRCm39) missense probably benign 0.00
R7372:Helz2 UTSW 2 180,880,216 (GRCm39) missense possibly damaging 0.61
R7512:Helz2 UTSW 2 180,877,393 (GRCm39) splice site probably null
R7512:Helz2 UTSW 2 180,872,647 (GRCm39) missense probably benign 0.00
R7583:Helz2 UTSW 2 180,879,365 (GRCm39) missense probably benign 0.06
R7724:Helz2 UTSW 2 180,873,789 (GRCm39) missense probably damaging 1.00
R7733:Helz2 UTSW 2 180,872,148 (GRCm39) missense possibly damaging 0.63
R7748:Helz2 UTSW 2 180,876,324 (GRCm39) missense probably damaging 1.00
R7774:Helz2 UTSW 2 180,875,784 (GRCm39) missense probably benign
R7799:Helz2 UTSW 2 180,879,782 (GRCm39) missense probably benign 0.15
R7841:Helz2 UTSW 2 180,874,695 (GRCm39) missense probably damaging 1.00
R7939:Helz2 UTSW 2 180,879,543 (GRCm39) missense probably damaging 0.99
R8026:Helz2 UTSW 2 180,881,998 (GRCm39) missense probably benign 0.34
R8030:Helz2 UTSW 2 180,879,689 (GRCm39) missense possibly damaging 0.55
R8080:Helz2 UTSW 2 180,880,055 (GRCm39) missense probably damaging 0.99
R8237:Helz2 UTSW 2 180,871,124 (GRCm39) missense possibly damaging 0.65
R8245:Helz2 UTSW 2 180,879,895 (GRCm39) missense probably damaging 1.00
R8304:Helz2 UTSW 2 180,871,950 (GRCm39) missense probably benign 0.03
R8486:Helz2 UTSW 2 180,871,124 (GRCm39) missense probably damaging 1.00
R8556:Helz2 UTSW 2 180,871,350 (GRCm39) missense probably damaging 1.00
R8878:Helz2 UTSW 2 180,874,560 (GRCm39) missense possibly damaging 0.67
R8907:Helz2 UTSW 2 180,874,920 (GRCm39) missense possibly damaging 0.47
R8911:Helz2 UTSW 2 180,880,173 (GRCm39) missense
R8953:Helz2 UTSW 2 180,874,884 (GRCm39) missense probably damaging 1.00
R8963:Helz2 UTSW 2 180,871,407 (GRCm39) missense probably damaging 1.00
R8969:Helz2 UTSW 2 180,879,581 (GRCm39) missense probably benign 0.19
R8976:Helz2 UTSW 2 180,876,486 (GRCm39) missense possibly damaging 0.46
R9015:Helz2 UTSW 2 180,870,792 (GRCm39) missense probably damaging 1.00
R9031:Helz2 UTSW 2 180,874,261 (GRCm39) missense possibly damaging 0.78
R9052:Helz2 UTSW 2 180,881,968 (GRCm39) missense possibly damaging 0.78
R9089:Helz2 UTSW 2 180,881,433 (GRCm39) missense probably damaging 1.00
R9145:Helz2 UTSW 2 180,881,848 (GRCm39) missense probably damaging 1.00
R9185:Helz2 UTSW 2 180,871,883 (GRCm39) missense probably benign
R9186:Helz2 UTSW 2 180,876,457 (GRCm39) missense possibly damaging 0.57
R9373:Helz2 UTSW 2 180,882,741 (GRCm39) missense probably benign
R9407:Helz2 UTSW 2 180,881,975 (GRCm39) missense probably benign 0.01
R9465:Helz2 UTSW 2 180,874,710 (GRCm39) missense probably benign 0.01
R9502:Helz2 UTSW 2 180,878,245 (GRCm39) missense possibly damaging 0.47
R9538:Helz2 UTSW 2 180,882,014 (GRCm39) missense probably damaging 1.00
R9554:Helz2 UTSW 2 180,882,470 (GRCm39) missense probably damaging 0.96
R9659:Helz2 UTSW 2 180,882,025 (GRCm39) missense probably benign 0.00
R9800:Helz2 UTSW 2 180,882,616 (GRCm39) missense probably damaging 0.99
X0064:Helz2 UTSW 2 180,873,534 (GRCm39) missense probably damaging 1.00
Z1176:Helz2 UTSW 2 180,879,357 (GRCm39) missense probably benign 0.39
Z1177:Helz2 UTSW 2 180,877,754 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCAATGCTCTCTCAAAGGTCTC -3'
(R):5'- GCCCACAAAGGCTCATAGCTGAAG -3'

Sequencing Primer
(F):5'- AGTTTGAGCGCAGGAACTTC -3'
(R):5'- GCTCATAGCTGAAGGGACC -3'
Posted On 2015-02-04