Incidental Mutation 'ANU74:Sspo'
ID 262697
Institutional Source Beutler Lab
Gene Symbol Sspo
Ensembl Gene ENSMUSG00000029797
Gene Name SCO-spondin
Synonyms C79529, Scospondin
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # ANU74
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 48425163-48478184 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 48437893 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 1351 (G1351S)
Ref Sequence ENSEMBL: ENSMUSP00000047991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043676] [ENSMUST00000169350] [ENSMUST00000212740]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000043676
AA Change: G1351S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047991
Gene: ENSMUSG00000029797
AA Change: G1351S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
Pfam:VWD 154 219 7.4e-11 PFAM
C8 267 346 2.3e-10 SMART
Pfam:TIL 349 404 3.2e-13 PFAM
VWC 406 448 2e-1 SMART
VWD 433 593 5.08e-29 SMART
C8 631 703 2.14e-28 SMART
Pfam:TIL 706 759 5.8e-11 PFAM
VWC 856 924 4.76e-2 SMART
VWD 883 1042 9.59e-48 SMART
C8 1076 1150 3.62e-26 SMART
Pfam:TIL 1153 1209 2.6e-13 PFAM
LDLa 1253 1291 2.29e-13 SMART
LDLa 1293 1328 1.87e-9 SMART
LDLa 1329 1366 5.77e-10 SMART
LDLa 1369 1408 1.52e-9 SMART
LDLa 1442 1479 2.55e-11 SMART
LDLa 1480 1520 5.6e-8 SMART
LDLa 1533 1574 2.29e-4 SMART
TSP1 1575 1626 6.47e-13 SMART
TSP1 1631 1686 1.35e-10 SMART
Pfam:TIL 1690 1746 3.1e-9 PFAM
TSP1 1774 1827 6.94e-2 SMART
VWC 1829 1886 4.95e-9 SMART
low complexity region 1901 1911 N/A INTRINSIC
FA58C 1928 2085 1.4e-2 SMART
LDLa 2091 2128 1.48e-7 SMART
LDLa 2242 2279 5.68e-9 SMART
LDLa 2299 2336 5.77e-10 SMART
TSP1 2339 2389 1.42e-9 SMART
TSP1 2394 2446 6.36e-21 SMART
Pfam:TIL 2460 2511 5.7e-10 PFAM
VWC 2513 2567 2.48e-1 SMART
TSP1 2554 2605 3.07e-14 SMART
TSP1 2611 2664 4.05e-5 SMART
TSP1 2669 2719 1.83e-12 SMART
EGF_like 2733 2776 5.45e1 SMART
VWC 2783 2836 2.73e-11 SMART
TSP1 2823 2875 3.72e-13 SMART
TSP1 2878 2919 6.05e-4 SMART
Pfam:TIL 2926 2978 1.1e-11 PFAM
VWC 2980 3035 9.77e-2 SMART
TSP1 3022 3086 6.68e-6 SMART
TSP1 3091 3143 1.08e-14 SMART
Pfam:TIL 3147 3201 2.2e-9 PFAM
VWC 3203 3260 2.72e-1 SMART
TSP1 3247 3306 3.72e-4 SMART
TSP1 3311 3363 5.27e-4 SMART
Pfam:TIL 3365 3421 4.2e-9 PFAM
TSP1 3484 3529 1.87e-9 SMART
low complexity region 3591 3601 N/A INTRINSIC
TSP1 3660 3713 5.02e-10 SMART
TSP1 3730 3779 2.95e-7 SMART
TSP1 3796 3849 1.99e-13 SMART
TSP1 3854 3906 2.51e-10 SMART
Pfam:TIL 3909 3964 3.4e-11 PFAM
VWC 3966 4022 1.26e0 SMART
TSP1 4009 4059 4.05e-5 SMART
TSP1 4103 4155 3.19e-12 SMART
TSP1 4161 4213 2.87e-2 SMART
TSP1 4218 4269 1.45e-6 SMART
Pfam:TIL 4273 4328 2.1e-10 PFAM
TSP1 4468 4516 7.56e-5 SMART
low complexity region 4551 4562 N/A INTRINSIC
VWC 4578 4652 5.21e-1 SMART
TSP1 4619 4669 3.92e-12 SMART
Pfam:TIL 4671 4725 1.5e-11 PFAM
Pfam:TIL 4777 4835 3.1e-9 PFAM
VWC 4837 4892 1.8e-11 SMART
GHB 4904 4997 1.02e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169350
AA Change: G1476S

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131401
Gene: ENSMUSG00000029797
AA Change: G1476S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
VWD 185 341 4.36e-28 SMART
C8 390 469 2.3e-10 SMART
Pfam:TIL 472 527 8.6e-13 PFAM
VWC 529 571 2e-1 SMART
VWD 556 716 5.08e-29 SMART
C8 754 826 2.14e-28 SMART
Pfam:TIL 829 882 1.6e-10 PFAM
VWC 979 1047 4.76e-2 SMART
VWD 1006 1165 9.59e-48 SMART
C8 1201 1275 3.62e-26 SMART
Pfam:TIL 1278 1334 7e-13 PFAM
LDLa 1378 1416 2.29e-13 SMART
LDLa 1418 1453 1.87e-9 SMART
LDLa 1454 1491 5.77e-10 SMART
LDLa 1494 1533 1.52e-9 SMART
LDLa 1567 1604 2.55e-11 SMART
LDLa 1605 1645 5.6e-8 SMART
LDLa 1658 1699 2.29e-4 SMART
TSP1 1700 1751 6.47e-13 SMART
TSP1 1756 1811 1.35e-10 SMART
Pfam:TIL 1815 1871 8.3e-9 PFAM
VWC 1873 1928 2.42e-1 SMART
TSP1 1915 1968 6.94e-2 SMART
VWC 1970 2027 4.95e-9 SMART
low complexity region 2042 2052 N/A INTRINSIC
FA58C 2069 2226 1.4e-2 SMART
LDLa 2232 2269 1.48e-7 SMART
LDLa 2387 2424 5.68e-9 SMART
LDLa 2444 2481 5.77e-10 SMART
TSP1 2484 2534 1.42e-9 SMART
TSP1 2539 2591 6.36e-21 SMART
Pfam:TIL 2606 2656 1.8e-9 PFAM
VWC 2658 2712 2.48e-1 SMART
TSP1 2699 2750 3.07e-14 SMART
TSP1 2756 2809 4.05e-5 SMART
TSP1 2814 2864 1.83e-12 SMART
EGF_like 2878 2921 5.45e1 SMART
VWC 2928 2981 2.73e-11 SMART
TSP1 2968 3020 3.72e-13 SMART
TSP1 3023 3064 6.05e-4 SMART
Pfam:TIL 3071 3123 3e-11 PFAM
VWC 3125 3180 9.77e-2 SMART
TSP1 3167 3231 6.68e-6 SMART
TSP1 3236 3288 1.08e-14 SMART
Pfam:TIL 3292 3346 6e-9 PFAM
VWC 3348 3405 2.72e-1 SMART
TSP1 3392 3451 3.72e-4 SMART
TSP1 3456 3508 5.27e-4 SMART
Pfam:TIL 3510 3566 1.1e-8 PFAM
TSP1 3629 3674 1.87e-9 SMART
low complexity region 3734 3744 N/A INTRINSIC
TSP1 3803 3856 5.02e-10 SMART
TSP1 3873 3922 2.95e-7 SMART
TSP1 3939 3992 1.99e-13 SMART
TSP1 3997 4049 2.51e-10 SMART
Pfam:TIL 4052 4107 9.1e-11 PFAM
VWC 4109 4165 1.26e0 SMART
TSP1 4152 4202 4.05e-5 SMART
TSP1 4246 4298 3.19e-12 SMART
TSP1 4304 4356 2.87e-2 SMART
TSP1 4361 4412 1.45e-6 SMART
Pfam:TIL 4416 4471 5.6e-10 PFAM
TSP1 4611 4659 7.56e-5 SMART
low complexity region 4694 4705 N/A INTRINSIC
VWC 4721 4795 5.21e-1 SMART
TSP1 4762 4812 3.92e-12 SMART
Pfam:TIL 4814 4868 4e-11 PFAM
Pfam:TIL 4920 4978 8.4e-9 PFAM
VWC 4980 5035 1.8e-11 SMART
GHB 5050 5143 1.02e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000212740
AA Change: G1476S

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 G A 5: 50,118,380 (GRCm39) S1056L probably benign Het
Ankrd26 A T 6: 118,529,736 (GRCm39) D236E probably benign Het
Capn15 C T 17: 26,184,460 (GRCm39) W7* probably null Het
Celsr2 G A 3: 108,319,815 (GRCm39) T999M probably damaging Het
Chrd T A 16: 20,560,069 (GRCm39) M912K possibly damaging Het
Col9a1 A G 1: 24,224,409 (GRCm39) D197G unknown Het
Csf1r A G 18: 61,250,463 (GRCm39) E431G probably benign Het
Eloc A G 1: 16,713,574 (GRCm39) F115L possibly damaging Het
Fap T C 2: 62,378,113 (GRCm39) D193G probably damaging Het
Fscn2 T C 11: 120,253,162 (GRCm39) Y210H probably damaging Het
Fut9 G C 4: 25,620,802 (GRCm39) T4R probably benign Het
Grb2 A T 11: 115,536,733 (GRCm39) D131E probably benign Het
Hecw2 T C 1: 53,964,853 (GRCm39) T658A probably benign Het
Helz2 T C 2: 180,876,627 (GRCm39) E1289G probably benign Het
Hyou1 A G 9: 44,292,560 (GRCm39) N92D possibly damaging Het
Irf8 A C 8: 121,466,608 (GRCm39) I18L possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,089,660 (GRCm39) probably benign Het
Kif12 GC "GCCTCCACCCGGCGGTC,GCC" 4: 63,089,663 (GRCm39) probably null Het
Lamc2 A C 1: 153,007,581 (GRCm39) D864E probably benign Het
Map3k4 A G 17: 12,451,863 (GRCm39) V1475A probably damaging Het
Mapk8ip3 A C 17: 25,119,551 (GRCm39) M1030R possibly damaging Het
Mat1a A G 14: 40,833,099 (GRCm39) D94G probably benign Het
Myh15 T A 16: 48,993,295 (GRCm39) D1643E possibly damaging Het
Myo15b T C 11: 115,769,239 (GRCm39) F55L probably damaging Het
Nhlh2 A T 3: 101,919,970 (GRCm39) M1L probably benign Het
Nup214 T C 2: 31,924,978 (GRCm39) S1836P probably damaging Het
Olr1 G A 6: 129,477,032 (GRCm39) R78C possibly damaging Het
Or5m9 T A 2: 85,877,655 (GRCm39) Y276* probably null Het
Pam16 C A 16: 4,434,497 (GRCm39) V98F probably damaging Het
Pelp1 C T 11: 70,285,913 (GRCm39) V652I probably damaging Het
Pole A G 5: 110,437,236 (GRCm39) H67R probably benign Het
Rbms1 G T 2: 60,628,060 (GRCm39) A60E probably damaging Het
Recql4 A T 15: 76,589,957 (GRCm39) M789K possibly damaging Het
Rrn3 T C 16: 13,629,397 (GRCm39) F571S possibly damaging Het
Ryr3 T C 2: 112,661,575 (GRCm39) probably null Het
Sec61b C A 4: 47,474,922 (GRCm39) N26K possibly damaging Het
Serinc1 T C 10: 57,395,938 (GRCm39) E284G probably benign Het
Slc30a9 G A 5: 67,507,195 (GRCm39) D496N probably damaging Het
Slc44a4 G A 17: 35,140,554 (GRCm39) R249H probably damaging Het
Slc6a13 A C 6: 121,311,835 (GRCm39) D404A probably benign Het
Spata18 A G 5: 73,828,456 (GRCm39) E225G probably damaging Het
Tgm3 T C 2: 129,890,310 (GRCm39) V691A probably damaging Het
Tns3 C T 11: 8,442,149 (GRCm39) R738Q probably benign Het
Tyk2 A T 9: 21,027,454 (GRCm39) I506N probably damaging Het
Ube2v1 G A 2: 167,452,264 (GRCm39) T113I probably damaging Het
Vmn1r177 A G 7: 23,565,645 (GRCm39) V77A possibly damaging Het
Vmn2r14 A T 5: 109,366,910 (GRCm39) S437T probably benign Het
Vmn2r78 G C 7: 86,570,273 (GRCm39) V264L possibly damaging Het
Zfp956 T G 6: 47,940,507 (GRCm39) Y289D probably benign Het
Other mutations in Sspo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Sspo APN 6 48,447,387 (GRCm39) missense probably benign 0.02
IGL00339:Sspo APN 6 48,460,680 (GRCm39) splice site probably benign
IGL00391:Sspo APN 6 48,474,320 (GRCm39) missense probably damaging 0.96
IGL00433:Sspo APN 6 48,466,970 (GRCm39) missense probably damaging 1.00
IGL00471:Sspo APN 6 48,475,147 (GRCm39) splice site probably benign
IGL00500:Sspo APN 6 48,474,355 (GRCm39) nonsense probably null
IGL00537:Sspo APN 6 48,475,147 (GRCm39) splice site probably benign
IGL00540:Sspo APN 6 48,475,147 (GRCm39) splice site probably benign
IGL01060:Sspo APN 6 48,426,413 (GRCm39) nonsense probably null
IGL01090:Sspo APN 6 48,467,059 (GRCm39) missense probably benign 0.08
IGL01125:Sspo APN 6 48,469,822 (GRCm39) missense probably damaging 1.00
IGL01447:Sspo APN 6 48,441,600 (GRCm39) splice site probably null
IGL01457:Sspo APN 6 48,475,277 (GRCm39) missense probably benign 0.00
IGL01481:Sspo APN 6 48,425,449 (GRCm39) missense probably benign 0.41
IGL01485:Sspo APN 6 48,455,665 (GRCm39) missense probably damaging 1.00
IGL01544:Sspo APN 6 48,467,953 (GRCm39) missense probably damaging 0.99
IGL01575:Sspo APN 6 48,435,976 (GRCm39) missense probably benign 0.01
IGL01589:Sspo APN 6 48,428,112 (GRCm39) missense probably damaging 1.00
IGL01601:Sspo APN 6 48,463,313 (GRCm39) missense probably benign 0.33
IGL01644:Sspo APN 6 48,429,436 (GRCm39) missense probably benign
IGL01659:Sspo APN 6 48,451,377 (GRCm39) missense probably damaging 1.00
IGL01801:Sspo APN 6 48,434,072 (GRCm39) missense probably damaging 1.00
IGL01872:Sspo APN 6 48,431,623 (GRCm39) missense probably damaging 0.99
IGL01874:Sspo APN 6 48,429,124 (GRCm39) missense probably damaging 1.00
IGL01936:Sspo APN 6 48,452,821 (GRCm39) missense probably damaging 1.00
IGL01941:Sspo APN 6 48,472,116 (GRCm39) missense probably benign 0.19
IGL01986:Sspo APN 6 48,460,237 (GRCm39) missense probably benign 0.05
IGL01987:Sspo APN 6 48,454,558 (GRCm39) splice site probably null
IGL02170:Sspo APN 6 48,444,917 (GRCm39) missense possibly damaging 0.76
IGL02192:Sspo APN 6 48,436,502 (GRCm39) missense possibly damaging 0.86
IGL02210:Sspo APN 6 48,477,426 (GRCm39) missense probably damaging 1.00
IGL02225:Sspo APN 6 48,461,268 (GRCm39) missense probably benign 0.09
IGL02280:Sspo APN 6 48,473,165 (GRCm39) missense probably damaging 1.00
IGL02303:Sspo APN 6 48,461,639 (GRCm39) missense possibly damaging 0.52
IGL02397:Sspo APN 6 48,438,572 (GRCm39) missense probably benign 0.35
IGL02451:Sspo APN 6 48,437,237 (GRCm39) splice site probably benign
IGL02500:Sspo APN 6 48,455,313 (GRCm39) nonsense probably null
IGL02519:Sspo APN 6 48,461,762 (GRCm39) missense probably damaging 1.00
IGL02549:Sspo APN 6 48,428,707 (GRCm39) missense possibly damaging 0.81
IGL02562:Sspo APN 6 48,467,056 (GRCm39) splice site probably null
IGL02673:Sspo APN 6 48,452,794 (GRCm39) missense probably damaging 1.00
IGL02673:Sspo APN 6 48,475,709 (GRCm39) critical splice donor site probably null
IGL02719:Sspo APN 6 48,459,601 (GRCm39) missense probably benign 0.39
IGL02793:Sspo APN 6 48,464,828 (GRCm39) splice site probably benign
IGL03003:Sspo APN 6 48,432,021 (GRCm39) missense probably damaging 0.98
IGL03056:Sspo APN 6 48,447,472 (GRCm39) missense probably benign 0.17
IGL03105:Sspo APN 6 48,450,592 (GRCm39) splice site probably benign
IGL03116:Sspo APN 6 48,471,035 (GRCm39) missense probably benign 0.32
IGL03163:Sspo APN 6 48,461,266 (GRCm39) missense probably benign 0.19
IGL03198:Sspo APN 6 48,454,516 (GRCm39) missense probably benign 0.31
IGL03365:Sspo APN 6 48,436,349 (GRCm39) missense possibly damaging 0.82
Barrier UTSW 6 48,472,146 (GRCm39) missense possibly damaging 0.58
R0312_sspo_280 UTSW 6 48,432,335 (GRCm39) missense possibly damaging 0.52
R3112_Sspo_731 UTSW 6 48,434,534 (GRCm39) missense probably damaging 1.00
R3498_Sspo_650 UTSW 6 48,444,914 (GRCm39) missense possibly damaging 0.58
R4180_Sspo_324 UTSW 6 48,475,329 (GRCm39) critical splice donor site probably null
spotsylvania UTSW 6 48,453,505 (GRCm39) nonsense probably null
IGL02984:Sspo UTSW 6 48,472,089 (GRCm39) missense probably benign 0.33
IGL03052:Sspo UTSW 6 48,437,387 (GRCm39) missense probably damaging 1.00
IGL03134:Sspo UTSW 6 48,427,999 (GRCm39) missense probably benign 0.28
PIT4531001:Sspo UTSW 6 48,458,173 (GRCm39) missense probably benign
R0087:Sspo UTSW 6 48,454,719 (GRCm39) missense probably damaging 1.00
R0122:Sspo UTSW 6 48,450,910 (GRCm39) missense possibly damaging 0.95
R0129:Sspo UTSW 6 48,432,352 (GRCm39) missense probably benign 0.00
R0164:Sspo UTSW 6 48,471,128 (GRCm39) splice site probably benign
R0195:Sspo UTSW 6 48,463,570 (GRCm39) missense probably benign
R0200:Sspo UTSW 6 48,463,349 (GRCm39) missense probably null 0.01
R0201:Sspo UTSW 6 48,432,686 (GRCm39) missense possibly damaging 0.64
R0241:Sspo UTSW 6 48,438,429 (GRCm39) missense possibly damaging 0.82
R0241:Sspo UTSW 6 48,438,429 (GRCm39) missense possibly damaging 0.82
R0243:Sspo UTSW 6 48,470,120 (GRCm39) missense probably damaging 1.00
R0268:Sspo UTSW 6 48,442,489 (GRCm39) missense probably benign 0.26
R0312:Sspo UTSW 6 48,432,335 (GRCm39) missense possibly damaging 0.52
R0449:Sspo UTSW 6 48,443,674 (GRCm39) missense probably damaging 1.00
R0523:Sspo UTSW 6 48,428,794 (GRCm39) missense probably benign 0.20
R0576:Sspo UTSW 6 48,441,876 (GRCm39) splice site probably null
R0671:Sspo UTSW 6 48,467,325 (GRCm39) splice site probably benign
R0828:Sspo UTSW 6 48,475,668 (GRCm39) missense probably damaging 1.00
R0880:Sspo UTSW 6 48,452,869 (GRCm39) missense possibly damaging 0.69
R0903:Sspo UTSW 6 48,432,242 (GRCm39) critical splice acceptor site probably null
R1051:Sspo UTSW 6 48,468,389 (GRCm39) nonsense probably null
R1083:Sspo UTSW 6 48,447,933 (GRCm39) missense possibly damaging 0.91
R1109:Sspo UTSW 6 48,474,377 (GRCm39) missense probably damaging 1.00
R1118:Sspo UTSW 6 48,436,352 (GRCm39) missense probably damaging 0.97
R1256:Sspo UTSW 6 48,434,573 (GRCm39) missense probably damaging 1.00
R1342:Sspo UTSW 6 48,438,569 (GRCm39) missense probably benign 0.07
R1355:Sspo UTSW 6 48,425,560 (GRCm39) missense probably benign 0.41
R1370:Sspo UTSW 6 48,425,560 (GRCm39) missense probably benign 0.41
R1469:Sspo UTSW 6 48,467,916 (GRCm39) missense probably damaging 1.00
R1469:Sspo UTSW 6 48,467,916 (GRCm39) missense probably damaging 1.00
R1476:Sspo UTSW 6 48,440,334 (GRCm39) critical splice donor site probably null
R1566:Sspo UTSW 6 48,443,804 (GRCm39) critical splice donor site probably null
R1630:Sspo UTSW 6 48,434,658 (GRCm39) missense probably benign 0.01
R1686:Sspo UTSW 6 48,437,334 (GRCm39) missense probably benign 0.00
R1707:Sspo UTSW 6 48,454,811 (GRCm39) missense probably damaging 0.99
R1727:Sspo UTSW 6 48,471,782 (GRCm39) missense probably damaging 1.00
R1822:Sspo UTSW 6 48,469,820 (GRCm39) missense possibly damaging 0.75
R1831:Sspo UTSW 6 48,466,720 (GRCm39) missense probably damaging 1.00
R1835:Sspo UTSW 6 48,434,274 (GRCm39) missense probably damaging 0.97
R1862:Sspo UTSW 6 48,467,940 (GRCm39) missense probably damaging 0.98
R1878:Sspo UTSW 6 48,436,300 (GRCm39) missense possibly damaging 0.92
R1900:Sspo UTSW 6 48,436,284 (GRCm39) missense probably benign 0.22
R1945:Sspo UTSW 6 48,466,707 (GRCm39) missense possibly damaging 0.93
R1957:Sspo UTSW 6 48,455,207 (GRCm39) missense probably damaging 0.99
R1990:Sspo UTSW 6 48,427,984 (GRCm39) missense probably benign 0.00
R1996:Sspo UTSW 6 48,452,424 (GRCm39) missense possibly damaging 0.50
R2049:Sspo UTSW 6 48,440,465 (GRCm39) missense probably benign 0.36
R2049:Sspo UTSW 6 48,437,697 (GRCm39) splice site probably benign
R2064:Sspo UTSW 6 48,450,596 (GRCm39) missense probably damaging 0.99
R2072:Sspo UTSW 6 48,450,451 (GRCm39) missense probably benign 0.01
R2096:Sspo UTSW 6 48,438,608 (GRCm39) missense probably benign
R2106:Sspo UTSW 6 48,443,250 (GRCm39) missense possibly damaging 0.96
R2230:Sspo UTSW 6 48,477,437 (GRCm39) missense probably benign 0.11
R2230:Sspo UTSW 6 48,425,606 (GRCm39) missense probably damaging 0.97
R2232:Sspo UTSW 6 48,425,606 (GRCm39) missense probably damaging 0.97
R2351:Sspo UTSW 6 48,441,803 (GRCm39) missense probably damaging 1.00
R2423:Sspo UTSW 6 48,430,989 (GRCm39) missense probably benign 0.00
R2508:Sspo UTSW 6 48,441,298 (GRCm39) missense probably damaging 1.00
R3110:Sspo UTSW 6 48,434,534 (GRCm39) missense probably damaging 1.00
R3112:Sspo UTSW 6 48,434,534 (GRCm39) missense probably damaging 1.00
R3413:Sspo UTSW 6 48,457,631 (GRCm39) missense probably damaging 1.00
R3433:Sspo UTSW 6 48,452,885 (GRCm39) splice site probably null
R3498:Sspo UTSW 6 48,444,914 (GRCm39) missense possibly damaging 0.58
R3732:Sspo UTSW 6 48,426,864 (GRCm39) missense probably damaging 1.00
R3816:Sspo UTSW 6 48,458,037 (GRCm39) missense possibly damaging 0.77
R3818:Sspo UTSW 6 48,458,037 (GRCm39) missense possibly damaging 0.77
R3819:Sspo UTSW 6 48,458,037 (GRCm39) missense possibly damaging 0.77
R3838:Sspo UTSW 6 48,457,754 (GRCm39) missense probably damaging 1.00
R3850:Sspo UTSW 6 48,469,424 (GRCm39) missense probably damaging 1.00
R3880:Sspo UTSW 6 48,471,874 (GRCm39) missense probably benign 0.38
R3893:Sspo UTSW 6 48,453,505 (GRCm39) nonsense probably null
R4116:Sspo UTSW 6 48,433,928 (GRCm39) missense probably damaging 0.99
R4179:Sspo UTSW 6 48,475,329 (GRCm39) critical splice donor site probably null
R4180:Sspo UTSW 6 48,475,329 (GRCm39) critical splice donor site probably null
R4207:Sspo UTSW 6 48,455,227 (GRCm39) missense probably benign 0.00
R4210:Sspo UTSW 6 48,441,835 (GRCm39) missense probably benign 0.00
R4223:Sspo UTSW 6 48,428,091 (GRCm39) missense possibly damaging 0.54
R4224:Sspo UTSW 6 48,428,091 (GRCm39) missense possibly damaging 0.54
R4225:Sspo UTSW 6 48,428,091 (GRCm39) missense possibly damaging 0.54
R4229:Sspo UTSW 6 48,467,868 (GRCm39) missense probably benign 0.00
R4230:Sspo UTSW 6 48,467,868 (GRCm39) missense probably benign 0.00
R4363:Sspo UTSW 6 48,475,665 (GRCm39) missense probably damaging 1.00
R4370:Sspo UTSW 6 48,443,282 (GRCm39) missense probably null 0.14
R4407:Sspo UTSW 6 48,437,454 (GRCm39) missense probably damaging 1.00
R4438:Sspo UTSW 6 48,464,287 (GRCm39) missense probably damaging 1.00
R4454:Sspo UTSW 6 48,464,159 (GRCm39) missense probably benign 0.05
R4455:Sspo UTSW 6 48,442,450 (GRCm39) missense probably damaging 1.00
R4561:Sspo UTSW 6 48,452,468 (GRCm39) splice site probably null
R4574:Sspo UTSW 6 48,442,457 (GRCm39) missense probably damaging 1.00
R4578:Sspo UTSW 6 48,440,307 (GRCm39) missense possibly damaging 0.58
R4653:Sspo UTSW 6 48,455,580 (GRCm39) missense probably damaging 1.00
R4656:Sspo UTSW 6 48,431,010 (GRCm39) missense possibly damaging 0.65
R4659:Sspo UTSW 6 48,461,147 (GRCm39) missense probably damaging 1.00
R4664:Sspo UTSW 6 48,450,468 (GRCm39) missense possibly damaging 0.82
R4685:Sspo UTSW 6 48,469,828 (GRCm39) missense probably damaging 0.98
R4692:Sspo UTSW 6 48,459,621 (GRCm39) missense probably damaging 1.00
R4703:Sspo UTSW 6 48,477,387 (GRCm39) missense probably damaging 1.00
R4704:Sspo UTSW 6 48,475,638 (GRCm39) missense probably damaging 1.00
R4738:Sspo UTSW 6 48,455,330 (GRCm39) missense possibly damaging 0.78
R4766:Sspo UTSW 6 48,447,514 (GRCm39) missense probably benign 0.04
R4771:Sspo UTSW 6 48,437,813 (GRCm39) missense probably damaging 1.00
R4790:Sspo UTSW 6 48,437,705 (GRCm39) missense probably benign 0.04
R4792:Sspo UTSW 6 48,438,519 (GRCm39) missense probably benign 0.00
R4808:Sspo UTSW 6 48,428,095 (GRCm39) missense probably damaging 1.00
R4812:Sspo UTSW 6 48,467,444 (GRCm39) missense probably benign 0.00
R4883:Sspo UTSW 6 48,437,756 (GRCm39) missense probably benign 0.00
R4906:Sspo UTSW 6 48,442,664 (GRCm39) critical splice acceptor site probably null
R4934:Sspo UTSW 6 48,442,486 (GRCm39) missense probably damaging 1.00
R4945:Sspo UTSW 6 48,444,021 (GRCm39) splice site probably null
R4967:Sspo UTSW 6 48,441,539 (GRCm39) missense probably damaging 0.97
R5016:Sspo UTSW 6 48,429,214 (GRCm39) nonsense probably null
R5018:Sspo UTSW 6 48,432,634 (GRCm39) missense probably damaging 1.00
R5034:Sspo UTSW 6 48,457,757 (GRCm39) missense possibly damaging 0.93
R5044:Sspo UTSW 6 48,443,889 (GRCm39) critical splice acceptor site probably null
R5055:Sspo UTSW 6 48,441,729 (GRCm39) missense probably damaging 1.00
R5087:Sspo UTSW 6 48,465,405 (GRCm39) missense possibly damaging 0.51
R5155:Sspo UTSW 6 48,437,408 (GRCm39) missense probably benign 0.03
R5223:Sspo UTSW 6 48,455,258 (GRCm39) missense probably damaging 1.00
R5249:Sspo UTSW 6 48,470,244 (GRCm39) missense probably damaging 0.98
R5257:Sspo UTSW 6 48,453,428 (GRCm39) missense probably damaging 1.00
R5258:Sspo UTSW 6 48,453,428 (GRCm39) missense probably damaging 1.00
R5276:Sspo UTSW 6 48,467,401 (GRCm39) missense probably damaging 1.00
R5307:Sspo UTSW 6 48,431,784 (GRCm39) missense probably damaging 0.99
R5341:Sspo UTSW 6 48,436,549 (GRCm39) missense probably damaging 1.00
R5361:Sspo UTSW 6 48,443,247 (GRCm39) missense probably benign 0.02
R5385:Sspo UTSW 6 48,439,187 (GRCm39) missense probably benign 0.18
R5394:Sspo UTSW 6 48,472,194 (GRCm39) missense possibly damaging 0.52
R5477:Sspo UTSW 6 48,475,327 (GRCm39) missense possibly damaging 0.60
R5490:Sspo UTSW 6 48,470,214 (GRCm39) missense probably benign 0.33
R5512:Sspo UTSW 6 48,432,605 (GRCm39) missense probably damaging 0.97
R5518:Sspo UTSW 6 48,473,588 (GRCm39) missense possibly damaging 0.92
R5530:Sspo UTSW 6 48,442,517 (GRCm39) missense probably damaging 0.97
R5538:Sspo UTSW 6 48,429,112 (GRCm39) missense probably damaging 0.99
R5590:Sspo UTSW 6 48,451,425 (GRCm39) missense probably damaging 1.00
R5613:Sspo UTSW 6 48,431,978 (GRCm39) missense possibly damaging 0.79
R5638:Sspo UTSW 6 48,469,825 (GRCm39) missense possibly damaging 0.86
R5809:Sspo UTSW 6 48,436,979 (GRCm39) missense possibly damaging 0.59
R5810:Sspo UTSW 6 48,460,832 (GRCm39) missense probably benign 0.02
R5814:Sspo UTSW 6 48,428,818 (GRCm39) missense probably damaging 1.00
R5915:Sspo UTSW 6 48,468,418 (GRCm39) missense possibly damaging 0.83
R5915:Sspo UTSW 6 48,441,530 (GRCm39) missense probably benign 0.00
R5979:Sspo UTSW 6 48,440,627 (GRCm39) missense probably benign 0.20
R5996:Sspo UTSW 6 48,471,110 (GRCm39) missense possibly damaging 0.87
R6012:Sspo UTSW 6 48,428,305 (GRCm39) missense probably benign 0.00
R6025:Sspo UTSW 6 48,463,720 (GRCm39) missense possibly damaging 0.83
R6120:Sspo UTSW 6 48,442,510 (GRCm39) missense probably damaging 1.00
R6150:Sspo UTSW 6 48,463,313 (GRCm39) missense probably benign 0.33
R6221:Sspo UTSW 6 48,440,639 (GRCm39) missense probably damaging 1.00
R6261:Sspo UTSW 6 48,439,125 (GRCm39) missense possibly damaging 0.75
R6312:Sspo UTSW 6 48,434,300 (GRCm39) critical splice donor site probably null
R6372:Sspo UTSW 6 48,449,475 (GRCm39) missense probably damaging 1.00
R6456:Sspo UTSW 6 48,428,740 (GRCm39) missense probably benign 0.08
R6497:Sspo UTSW 6 48,472,142 (GRCm39) missense possibly damaging 0.71
R6501:Sspo UTSW 6 48,472,146 (GRCm39) missense possibly damaging 0.58
R6617:Sspo UTSW 6 48,467,980 (GRCm39) missense possibly damaging 0.93
R6825:Sspo UTSW 6 48,442,459 (GRCm39) missense probably benign 0.04
R6831:Sspo UTSW 6 48,461,767 (GRCm39) missense possibly damaging 0.68
R6861:Sspo UTSW 6 48,464,889 (GRCm39) missense probably benign 0.15
R6961:Sspo UTSW 6 48,440,811 (GRCm39) missense probably benign 0.05
R6967:Sspo UTSW 6 48,466,728 (GRCm39) missense probably benign 0.21
R7016:Sspo UTSW 6 48,426,098 (GRCm39) missense probably damaging 1.00
R7035:Sspo UTSW 6 48,426,147 (GRCm39) splice site probably null
R7058:Sspo UTSW 6 48,425,516 (GRCm39) missense probably damaging 1.00
R7072:Sspo UTSW 6 48,431,913 (GRCm39) missense probably damaging 1.00
R7078:Sspo UTSW 6 48,437,313 (GRCm39) missense probably damaging 1.00
R7082:Sspo UTSW 6 48,455,543 (GRCm39) critical splice acceptor site probably null
R7120:Sspo UTSW 6 48,442,505 (GRCm39) missense probably benign 0.05
R7127:Sspo UTSW 6 48,426,446 (GRCm39) missense probably benign 0.02
R7146:Sspo UTSW 6 48,478,029 (GRCm39) missense probably benign 0.15
R7220:Sspo UTSW 6 48,453,540 (GRCm39) nonsense probably null
R7242:Sspo UTSW 6 48,450,886 (GRCm39) missense probably benign
R7261:Sspo UTSW 6 48,427,011 (GRCm39) missense possibly damaging 0.52
R7313:Sspo UTSW 6 48,450,390 (GRCm39) missense probably benign 0.04
R7313:Sspo UTSW 6 48,431,762 (GRCm39) missense probably damaging 1.00
R7323:Sspo UTSW 6 48,438,581 (GRCm39) missense possibly damaging 0.93
R7330:Sspo UTSW 6 48,452,396 (GRCm39) missense probably benign 0.00
R7351:Sspo UTSW 6 48,441,855 (GRCm39) missense possibly damaging 0.89
R7467:Sspo UTSW 6 48,463,237 (GRCm39) missense probably damaging 1.00
R7475:Sspo UTSW 6 48,432,794 (GRCm39) missense probably benign 0.37
R7489:Sspo UTSW 6 48,450,647 (GRCm39) missense probably damaging 0.99
R7508:Sspo UTSW 6 48,443,633 (GRCm39) missense probably damaging 1.00
R7515:Sspo UTSW 6 48,470,820 (GRCm39) missense probably damaging 1.00
R7564:Sspo UTSW 6 48,426,434 (GRCm39) missense probably benign 0.04
R7607:Sspo UTSW 6 48,466,661 (GRCm39) missense probably damaging 1.00
R7620:Sspo UTSW 6 48,444,020 (GRCm39) critical splice donor site probably null
R7667:Sspo UTSW 6 48,452,305 (GRCm39) nonsense probably null
R7691:Sspo UTSW 6 48,461,163 (GRCm39) missense probably benign 0.12
R7707:Sspo UTSW 6 48,438,461 (GRCm39) missense probably benign 0.01
R7723:Sspo UTSW 6 48,441,572 (GRCm39) missense probably damaging 0.99
R7748:Sspo UTSW 6 48,426,399 (GRCm39) nonsense probably null
R7767:Sspo UTSW 6 48,428,316 (GRCm39) missense probably damaging 0.96
R7792:Sspo UTSW 6 48,431,624 (GRCm39) missense probably damaging 0.98
R7878:Sspo UTSW 6 48,469,460 (GRCm39) missense probably damaging 1.00
R7893:Sspo UTSW 6 48,440,244 (GRCm39) missense probably benign 0.02
R7942:Sspo UTSW 6 48,465,434 (GRCm39) splice site probably null
R7952:Sspo UTSW 6 48,464,263 (GRCm39) missense probably damaging 1.00
R7981:Sspo UTSW 6 48,445,428 (GRCm39) missense probably benign
R7995:Sspo UTSW 6 48,469,823 (GRCm39) missense probably damaging 1.00
R8088:Sspo UTSW 6 48,434,547 (GRCm39) missense probably damaging 1.00
R8129:Sspo UTSW 6 48,443,959 (GRCm39) missense possibly damaging 0.79
R8145:Sspo UTSW 6 48,444,683 (GRCm39) missense possibly damaging 0.49
R8202:Sspo UTSW 6 48,434,534 (GRCm39) missense probably damaging 1.00
R8211:Sspo UTSW 6 48,469,543 (GRCm39) critical splice donor site probably null
R8240:Sspo UTSW 6 48,460,436 (GRCm39) missense possibly damaging 0.84
R8252:Sspo UTSW 6 48,462,386 (GRCm39) missense probably damaging 0.99
R8270:Sspo UTSW 6 48,426,897 (GRCm39) missense probably benign
R8272:Sspo UTSW 6 48,425,453 (GRCm39) missense probably benign 0.03
R8316:Sspo UTSW 6 48,459,622 (GRCm39) missense probably damaging 1.00
R8384:Sspo UTSW 6 48,459,598 (GRCm39) missense probably damaging 1.00
R8390:Sspo UTSW 6 48,444,896 (GRCm39) missense probably benign 0.00
R8770:Sspo UTSW 6 48,451,206 (GRCm39) missense probably null 1.00
R8827:Sspo UTSW 6 48,434,606 (GRCm39) missense possibly damaging 0.59
R8882:Sspo UTSW 6 48,452,390 (GRCm39) missense probably damaging 1.00
R8886:Sspo UTSW 6 48,458,201 (GRCm39) missense possibly damaging 0.92
R8946:Sspo UTSW 6 48,434,071 (GRCm39) missense probably damaging 1.00
R8947:Sspo UTSW 6 48,425,504 (GRCm39) missense probably damaging 1.00
R9028:Sspo UTSW 6 48,473,087 (GRCm39) missense probably benign 0.38
R9043:Sspo UTSW 6 48,470,214 (GRCm39) missense probably benign 0.07
R9056:Sspo UTSW 6 48,450,608 (GRCm39) missense probably damaging 0.97
R9071:Sspo UTSW 6 48,433,982 (GRCm39) missense probably benign 0.00
R9133:Sspo UTSW 6 48,434,747 (GRCm39) missense possibly damaging 0.81
R9187:Sspo UTSW 6 48,472,223 (GRCm39) missense probably damaging 1.00
R9205:Sspo UTSW 6 48,432,806 (GRCm39) missense probably benign 0.03
R9213:Sspo UTSW 6 48,440,869 (GRCm39) missense possibly damaging 0.91
R9214:Sspo UTSW 6 48,440,869 (GRCm39) missense possibly damaging 0.91
R9215:Sspo UTSW 6 48,440,869 (GRCm39) missense possibly damaging 0.91
R9235:Sspo UTSW 6 48,466,718 (GRCm39) missense probably damaging 1.00
R9254:Sspo UTSW 6 48,464,928 (GRCm39) missense probably damaging 1.00
R9291:Sspo UTSW 6 48,473,330 (GRCm39) missense probably damaging 1.00
R9312:Sspo UTSW 6 48,445,396 (GRCm39) missense probably benign 0.00
R9357:Sspo UTSW 6 48,443,989 (GRCm39) missense possibly damaging 0.77
R9480:Sspo UTSW 6 48,470,820 (GRCm39) missense probably damaging 1.00
R9586:Sspo UTSW 6 48,458,039 (GRCm39) missense probably benign 0.03
R9660:Sspo UTSW 6 48,432,707 (GRCm39) missense probably damaging 1.00
R9661:Sspo UTSW 6 48,455,272 (GRCm39) nonsense probably null
R9728:Sspo UTSW 6 48,432,707 (GRCm39) missense probably damaging 1.00
R9776:Sspo UTSW 6 48,439,269 (GRCm39) missense probably benign 0.00
RF009:Sspo UTSW 6 48,436,919 (GRCm39) nonsense probably null
X0060:Sspo UTSW 6 48,457,728 (GRCm39) missense probably damaging 1.00
X0060:Sspo UTSW 6 48,443,228 (GRCm39) missense probably damaging 1.00
X0063:Sspo UTSW 6 48,474,356 (GRCm39) missense probably damaging 0.96
X0065:Sspo UTSW 6 48,438,618 (GRCm39) missense probably benign 0.00
Z1176:Sspo UTSW 6 48,458,227 (GRCm39) missense probably damaging 1.00
Z1177:Sspo UTSW 6 48,467,824 (GRCm39) missense probably damaging 1.00
Z1177:Sspo UTSW 6 48,467,482 (GRCm39) nonsense probably null
Z1177:Sspo UTSW 6 48,450,369 (GRCm39) missense probably damaging 0.99
Z1177:Sspo UTSW 6 48,447,918 (GRCm39) missense probably benign 0.16
Z1177:Sspo UTSW 6 48,441,750 (GRCm39) missense possibly damaging 0.72
Z1177:Sspo UTSW 6 48,433,960 (GRCm39) missense probably benign 0.31
Z1186:Sspo UTSW 6 48,445,441 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCATCCTGAATCTGCTTGCTTGTC -3'
(R):5'- TACCTCTCCAGAGATGCAGCTCAC -3'

Sequencing Primer
(F):5'- ATGCCAGGTTGTGCCAC -3'
(R):5'- gttcttaaccactgaccaatcc -3'
Posted On 2015-02-04