Incidental Mutation 'ANU74:Sspo'
ID 262697
Institutional Source Beutler Lab
Gene Symbol Sspo
Ensembl Gene ENSMUSG00000029797
Gene Name SCO-spondin
Synonyms Scospondin, C79529
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # ANU74
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 48448229-48501250 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 48460959 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 1351 (G1351S)
Ref Sequence ENSEMBL: ENSMUSP00000047991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043676] [ENSMUST00000169350] [ENSMUST00000212740]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000043676
AA Change: G1351S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047991
Gene: ENSMUSG00000029797
AA Change: G1351S

signal peptide 1 17 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
Pfam:VWD 154 219 7.4e-11 PFAM
C8 267 346 2.3e-10 SMART
Pfam:TIL 349 404 3.2e-13 PFAM
VWC 406 448 2e-1 SMART
VWD 433 593 5.08e-29 SMART
C8 631 703 2.14e-28 SMART
Pfam:TIL 706 759 5.8e-11 PFAM
VWC 856 924 4.76e-2 SMART
VWD 883 1042 9.59e-48 SMART
C8 1076 1150 3.62e-26 SMART
Pfam:TIL 1153 1209 2.6e-13 PFAM
LDLa 1253 1291 2.29e-13 SMART
LDLa 1293 1328 1.87e-9 SMART
LDLa 1329 1366 5.77e-10 SMART
LDLa 1369 1408 1.52e-9 SMART
LDLa 1442 1479 2.55e-11 SMART
LDLa 1480 1520 5.6e-8 SMART
LDLa 1533 1574 2.29e-4 SMART
TSP1 1575 1626 6.47e-13 SMART
TSP1 1631 1686 1.35e-10 SMART
Pfam:TIL 1690 1746 3.1e-9 PFAM
TSP1 1774 1827 6.94e-2 SMART
VWC 1829 1886 4.95e-9 SMART
low complexity region 1901 1911 N/A INTRINSIC
FA58C 1928 2085 1.4e-2 SMART
LDLa 2091 2128 1.48e-7 SMART
LDLa 2242 2279 5.68e-9 SMART
LDLa 2299 2336 5.77e-10 SMART
TSP1 2339 2389 1.42e-9 SMART
TSP1 2394 2446 6.36e-21 SMART
Pfam:TIL 2460 2511 5.7e-10 PFAM
VWC 2513 2567 2.48e-1 SMART
TSP1 2554 2605 3.07e-14 SMART
TSP1 2611 2664 4.05e-5 SMART
TSP1 2669 2719 1.83e-12 SMART
EGF_like 2733 2776 5.45e1 SMART
VWC 2783 2836 2.73e-11 SMART
TSP1 2823 2875 3.72e-13 SMART
TSP1 2878 2919 6.05e-4 SMART
Pfam:TIL 2926 2978 1.1e-11 PFAM
VWC 2980 3035 9.77e-2 SMART
TSP1 3022 3086 6.68e-6 SMART
TSP1 3091 3143 1.08e-14 SMART
Pfam:TIL 3147 3201 2.2e-9 PFAM
VWC 3203 3260 2.72e-1 SMART
TSP1 3247 3306 3.72e-4 SMART
TSP1 3311 3363 5.27e-4 SMART
Pfam:TIL 3365 3421 4.2e-9 PFAM
TSP1 3484 3529 1.87e-9 SMART
low complexity region 3591 3601 N/A INTRINSIC
TSP1 3660 3713 5.02e-10 SMART
TSP1 3730 3779 2.95e-7 SMART
TSP1 3796 3849 1.99e-13 SMART
TSP1 3854 3906 2.51e-10 SMART
Pfam:TIL 3909 3964 3.4e-11 PFAM
VWC 3966 4022 1.26e0 SMART
TSP1 4009 4059 4.05e-5 SMART
TSP1 4103 4155 3.19e-12 SMART
TSP1 4161 4213 2.87e-2 SMART
TSP1 4218 4269 1.45e-6 SMART
Pfam:TIL 4273 4328 2.1e-10 PFAM
TSP1 4468 4516 7.56e-5 SMART
low complexity region 4551 4562 N/A INTRINSIC
VWC 4578 4652 5.21e-1 SMART
TSP1 4619 4669 3.92e-12 SMART
Pfam:TIL 4671 4725 1.5e-11 PFAM
Pfam:TIL 4777 4835 3.1e-9 PFAM
VWC 4837 4892 1.8e-11 SMART
GHB 4904 4997 1.02e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169350
AA Change: G1476S

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131401
Gene: ENSMUSG00000029797
AA Change: G1476S

signal peptide 1 17 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
VWD 185 341 4.36e-28 SMART
C8 390 469 2.3e-10 SMART
Pfam:TIL 472 527 8.6e-13 PFAM
VWC 529 571 2e-1 SMART
VWD 556 716 5.08e-29 SMART
C8 754 826 2.14e-28 SMART
Pfam:TIL 829 882 1.6e-10 PFAM
VWC 979 1047 4.76e-2 SMART
VWD 1006 1165 9.59e-48 SMART
C8 1201 1275 3.62e-26 SMART
Pfam:TIL 1278 1334 7e-13 PFAM
LDLa 1378 1416 2.29e-13 SMART
LDLa 1418 1453 1.87e-9 SMART
LDLa 1454 1491 5.77e-10 SMART
LDLa 1494 1533 1.52e-9 SMART
LDLa 1567 1604 2.55e-11 SMART
LDLa 1605 1645 5.6e-8 SMART
LDLa 1658 1699 2.29e-4 SMART
TSP1 1700 1751 6.47e-13 SMART
TSP1 1756 1811 1.35e-10 SMART
Pfam:TIL 1815 1871 8.3e-9 PFAM
VWC 1873 1928 2.42e-1 SMART
TSP1 1915 1968 6.94e-2 SMART
VWC 1970 2027 4.95e-9 SMART
low complexity region 2042 2052 N/A INTRINSIC
FA58C 2069 2226 1.4e-2 SMART
LDLa 2232 2269 1.48e-7 SMART
LDLa 2387 2424 5.68e-9 SMART
LDLa 2444 2481 5.77e-10 SMART
TSP1 2484 2534 1.42e-9 SMART
TSP1 2539 2591 6.36e-21 SMART
Pfam:TIL 2606 2656 1.8e-9 PFAM
VWC 2658 2712 2.48e-1 SMART
TSP1 2699 2750 3.07e-14 SMART
TSP1 2756 2809 4.05e-5 SMART
TSP1 2814 2864 1.83e-12 SMART
EGF_like 2878 2921 5.45e1 SMART
VWC 2928 2981 2.73e-11 SMART
TSP1 2968 3020 3.72e-13 SMART
TSP1 3023 3064 6.05e-4 SMART
Pfam:TIL 3071 3123 3e-11 PFAM
VWC 3125 3180 9.77e-2 SMART
TSP1 3167 3231 6.68e-6 SMART
TSP1 3236 3288 1.08e-14 SMART
Pfam:TIL 3292 3346 6e-9 PFAM
VWC 3348 3405 2.72e-1 SMART
TSP1 3392 3451 3.72e-4 SMART
TSP1 3456 3508 5.27e-4 SMART
Pfam:TIL 3510 3566 1.1e-8 PFAM
TSP1 3629 3674 1.87e-9 SMART
low complexity region 3734 3744 N/A INTRINSIC
TSP1 3803 3856 5.02e-10 SMART
TSP1 3873 3922 2.95e-7 SMART
TSP1 3939 3992 1.99e-13 SMART
TSP1 3997 4049 2.51e-10 SMART
Pfam:TIL 4052 4107 9.1e-11 PFAM
VWC 4109 4165 1.26e0 SMART
TSP1 4152 4202 4.05e-5 SMART
TSP1 4246 4298 3.19e-12 SMART
TSP1 4304 4356 2.87e-2 SMART
TSP1 4361 4412 1.45e-6 SMART
Pfam:TIL 4416 4471 5.6e-10 PFAM
TSP1 4611 4659 7.56e-5 SMART
low complexity region 4694 4705 N/A INTRINSIC
VWC 4721 4795 5.21e-1 SMART
TSP1 4762 4812 3.92e-12 SMART
Pfam:TIL 4814 4868 4e-11 PFAM
Pfam:TIL 4920 4978 8.4e-9 PFAM
VWC 4980 5035 1.8e-11 SMART
GHB 5050 5143 1.02e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000212740
AA Change: G1476S

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 G A 5: 49,961,038 S1056L probably benign Het
Ankrd26 A T 6: 118,552,775 D236E probably benign Het
Capn15 C T 17: 25,965,486 W7* probably null Het
Celsr2 G A 3: 108,412,499 T999M probably damaging Het
Chrd T A 16: 20,741,319 M912K possibly damaging Het
Col9a1 A G 1: 24,185,328 D197G unknown Het
Csf1r A G 18: 61,117,391 E431G probably benign Het
Eloc A G 1: 16,643,350 F115L possibly damaging Het
Fap T C 2: 62,547,769 D193G probably damaging Het
Fscn2 T C 11: 120,362,336 Y210H probably damaging Het
Fut9 G C 4: 25,620,802 T4R probably benign Het
Grb2 A T 11: 115,645,907 D131E probably benign Het
Hecw2 T C 1: 53,925,694 T658A probably benign Het
Helz2 T C 2: 181,234,834 E1289G probably benign Het
Hyou1 A G 9: 44,381,263 N92D possibly damaging Het
Irf8 A C 8: 120,739,869 I18L possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kif12 GC "GCCTCCACCCGGCGGTC,GCC" 4: 63,171,426 probably null Het
Lamc2 A C 1: 153,131,835 D864E probably benign Het
Map3k4 A G 17: 12,232,976 V1475A probably damaging Het
Mapk8ip3 A C 17: 24,900,577 M1030R possibly damaging Het
Mat1a A G 14: 41,111,142 D94G probably benign Het
Myh15 T A 16: 49,172,932 D1643E possibly damaging Het
Myo15b T C 11: 115,878,413 F55L probably damaging Het
Nhlh2 A T 3: 102,012,654 M1L probably benign Het
Nup214 T C 2: 32,034,966 S1836P probably damaging Het
Olfr1034 T A 2: 86,047,311 Y276* probably null Het
Olr1 G A 6: 129,500,069 R78C possibly damaging Het
Pam16 C A 16: 4,616,633 V98F probably damaging Het
Pelp1 C T 11: 70,395,087 V652I probably damaging Het
Pole A G 5: 110,289,370 H67R probably benign Het
Rbms1 G T 2: 60,797,716 A60E probably damaging Het
Recql4 A T 15: 76,705,757 M789K possibly damaging Het
Rrn3 T C 16: 13,811,533 F571S possibly damaging Het
Ryr3 T C 2: 112,831,230 probably null Het
Sec61b C A 4: 47,474,922 N26K possibly damaging Het
Serinc1 T C 10: 57,519,842 E284G probably benign Het
Slc30a9 G A 5: 67,349,852 D496N probably damaging Het
Slc44a4 G A 17: 34,921,578 R249H probably damaging Het
Slc6a13 A C 6: 121,334,876 D404A probably benign Het
Spata18 A G 5: 73,671,113 E225G probably damaging Het
Tgm3 T C 2: 130,048,390 V691A probably damaging Het
Tns3 C T 11: 8,492,149 R738Q probably benign Het
Tyk2 A T 9: 21,116,158 I506N probably damaging Het
Ube2v1 G A 2: 167,610,344 T113I probably damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn2r14 A T 5: 109,219,044 S437T probably benign Het
Vmn2r78 G C 7: 86,921,065 V264L possibly damaging Het
Zfp956 T G 6: 47,963,573 Y289D probably benign Het
Other mutations in Sspo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Sspo APN 6 48470453 missense probably benign 0.02
IGL00339:Sspo APN 6 48483746 splice site probably benign
IGL00391:Sspo APN 6 48497386 missense probably damaging 0.96
IGL00433:Sspo APN 6 48490036 missense probably damaging 1.00
IGL00471:Sspo APN 6 48498213 splice site probably benign
IGL00500:Sspo APN 6 48497421 nonsense probably null
IGL00537:Sspo APN 6 48498213 splice site probably benign
IGL00540:Sspo APN 6 48498213 splice site probably benign
IGL01060:Sspo APN 6 48449479 nonsense probably null
IGL01090:Sspo APN 6 48490125 missense probably benign 0.08
IGL01125:Sspo APN 6 48492888 missense probably damaging 1.00
IGL01447:Sspo APN 6 48464666 splice site probably null
IGL01457:Sspo APN 6 48498343 missense probably benign 0.00
IGL01481:Sspo APN 6 48448515 missense probably benign 0.41
IGL01485:Sspo APN 6 48478731 missense probably damaging 1.00
IGL01544:Sspo APN 6 48491019 missense probably damaging 0.99
IGL01575:Sspo APN 6 48459042 missense probably benign 0.01
IGL01589:Sspo APN 6 48451178 missense probably damaging 1.00
IGL01601:Sspo APN 6 48486379 missense probably benign 0.33
IGL01644:Sspo APN 6 48452502 missense probably benign
IGL01659:Sspo APN 6 48474443 missense probably damaging 1.00
IGL01801:Sspo APN 6 48457138 missense probably damaging 1.00
IGL01872:Sspo APN 6 48454689 missense probably damaging 0.99
IGL01874:Sspo APN 6 48452190 missense probably damaging 1.00
IGL01936:Sspo APN 6 48475887 missense probably damaging 1.00
IGL01941:Sspo APN 6 48495182 missense probably benign 0.19
IGL01986:Sspo APN 6 48483303 missense probably benign 0.05
IGL01987:Sspo APN 6 48477624 splice site probably null
IGL02170:Sspo APN 6 48467983 missense possibly damaging 0.76
IGL02192:Sspo APN 6 48459568 missense possibly damaging 0.86
IGL02210:Sspo APN 6 48500492 missense probably damaging 1.00
IGL02225:Sspo APN 6 48484334 missense probably benign 0.09
IGL02280:Sspo APN 6 48496231 missense probably damaging 1.00
IGL02303:Sspo APN 6 48484705 missense possibly damaging 0.52
IGL02397:Sspo APN 6 48461638 missense probably benign 0.35
IGL02451:Sspo APN 6 48460303 splice site probably benign
IGL02500:Sspo APN 6 48478379 nonsense probably null
IGL02519:Sspo APN 6 48484828 missense probably damaging 1.00
IGL02549:Sspo APN 6 48451773 missense possibly damaging 0.81
IGL02562:Sspo APN 6 48490122 splice site probably null
IGL02673:Sspo APN 6 48475860 missense probably damaging 1.00
IGL02673:Sspo APN 6 48498775 critical splice donor site probably null
IGL02719:Sspo APN 6 48482667 missense probably benign 0.39
IGL02793:Sspo APN 6 48487894 splice site probably benign
IGL03003:Sspo APN 6 48455087 missense probably damaging 0.98
IGL03056:Sspo APN 6 48470538 missense probably benign 0.17
IGL03105:Sspo APN 6 48473658 splice site probably benign
IGL03116:Sspo APN 6 48494101 missense probably benign 0.32
IGL03163:Sspo APN 6 48484332 missense probably benign 0.19
IGL03198:Sspo APN 6 48477582 missense probably benign 0.31
IGL03365:Sspo APN 6 48459415 missense possibly damaging 0.82
Barrier UTSW 6 48495212 missense possibly damaging 0.58
R0312_sspo_280 UTSW 6 48455401 missense possibly damaging 0.52
R3112_Sspo_731 UTSW 6 48457600 missense probably damaging 1.00
R3498_Sspo_650 UTSW 6 48467980 missense possibly damaging 0.58
R4180_Sspo_324 UTSW 6 48498395 critical splice donor site probably null
spotsylvania UTSW 6 48476571 nonsense probably null
IGL02984:Sspo UTSW 6 48495155 missense probably benign 0.33
IGL03052:Sspo UTSW 6 48460453 missense probably damaging 1.00
IGL03134:Sspo UTSW 6 48451065 missense probably benign 0.28
PIT4531001:Sspo UTSW 6 48481239 missense probably benign
R0087:Sspo UTSW 6 48477785 missense probably damaging 1.00
R0122:Sspo UTSW 6 48473976 missense possibly damaging 0.95
R0129:Sspo UTSW 6 48455418 missense probably benign 0.00
R0164:Sspo UTSW 6 48494194 splice site probably benign
R0195:Sspo UTSW 6 48486636 missense probably benign
R0200:Sspo UTSW 6 48486415 missense probably null 0.01
R0201:Sspo UTSW 6 48455752 missense possibly damaging 0.64
R0241:Sspo UTSW 6 48461495 missense possibly damaging 0.82
R0241:Sspo UTSW 6 48461495 missense possibly damaging 0.82
R0243:Sspo UTSW 6 48493186 missense probably damaging 1.00
R0268:Sspo UTSW 6 48465555 missense probably benign 0.26
R0312:Sspo UTSW 6 48455401 missense possibly damaging 0.52
R0449:Sspo UTSW 6 48466740 missense probably damaging 1.00
R0523:Sspo UTSW 6 48451860 missense probably benign 0.20
R0576:Sspo UTSW 6 48464942 splice site probably null
R0671:Sspo UTSW 6 48490391 splice site probably benign
R0828:Sspo UTSW 6 48498734 missense probably damaging 1.00
R0880:Sspo UTSW 6 48475935 missense possibly damaging 0.69
R0903:Sspo UTSW 6 48455308 critical splice acceptor site probably null
R1051:Sspo UTSW 6 48491455 nonsense probably null
R1083:Sspo UTSW 6 48470999 missense possibly damaging 0.91
R1109:Sspo UTSW 6 48497443 missense probably damaging 1.00
R1118:Sspo UTSW 6 48459418 missense probably damaging 0.97
R1256:Sspo UTSW 6 48457639 missense probably damaging 1.00
R1342:Sspo UTSW 6 48461635 missense probably benign 0.07
R1355:Sspo UTSW 6 48448626 missense probably benign 0.41
R1370:Sspo UTSW 6 48448626 missense probably benign 0.41
R1469:Sspo UTSW 6 48490982 missense probably damaging 1.00
R1469:Sspo UTSW 6 48490982 missense probably damaging 1.00
R1476:Sspo UTSW 6 48463400 critical splice donor site probably null
R1566:Sspo UTSW 6 48466870 critical splice donor site probably null
R1630:Sspo UTSW 6 48457724 missense probably benign 0.01
R1686:Sspo UTSW 6 48460400 missense probably benign 0.00
R1707:Sspo UTSW 6 48477877 missense probably damaging 0.99
R1727:Sspo UTSW 6 48494848 missense probably damaging 1.00
R1822:Sspo UTSW 6 48492886 missense possibly damaging 0.75
R1831:Sspo UTSW 6 48489786 missense probably damaging 1.00
R1835:Sspo UTSW 6 48457340 missense probably damaging 0.97
R1862:Sspo UTSW 6 48491006 missense probably damaging 0.98
R1878:Sspo UTSW 6 48459366 missense possibly damaging 0.92
R1900:Sspo UTSW 6 48459350 missense probably benign 0.22
R1945:Sspo UTSW 6 48489773 missense possibly damaging 0.93
R1957:Sspo UTSW 6 48478273 missense probably damaging 0.99
R1990:Sspo UTSW 6 48451050 missense probably benign 0.00
R1996:Sspo UTSW 6 48475490 missense possibly damaging 0.50
R2049:Sspo UTSW 6 48460763 splice site probably benign
R2049:Sspo UTSW 6 48463531 missense probably benign 0.36
R2064:Sspo UTSW 6 48473662 missense probably damaging 0.99
R2072:Sspo UTSW 6 48473517 missense probably benign 0.01
R2096:Sspo UTSW 6 48461674 missense probably benign
R2106:Sspo UTSW 6 48466316 missense possibly damaging 0.96
R2230:Sspo UTSW 6 48448672 missense probably damaging 0.97
R2230:Sspo UTSW 6 48500503 missense probably benign 0.11
R2232:Sspo UTSW 6 48448672 missense probably damaging 0.97
R2351:Sspo UTSW 6 48464869 missense probably damaging 1.00
R2423:Sspo UTSW 6 48454055 missense probably benign 0.00
R2508:Sspo UTSW 6 48464364 missense probably damaging 1.00
R3110:Sspo UTSW 6 48457600 missense probably damaging 1.00
R3112:Sspo UTSW 6 48457600 missense probably damaging 1.00
R3413:Sspo UTSW 6 48480697 missense probably damaging 1.00
R3433:Sspo UTSW 6 48475951 splice site probably null
R3498:Sspo UTSW 6 48467980 missense possibly damaging 0.58
R3732:Sspo UTSW 6 48449930 missense probably damaging 1.00
R3816:Sspo UTSW 6 48481103 missense possibly damaging 0.77
R3818:Sspo UTSW 6 48481103 missense possibly damaging 0.77
R3819:Sspo UTSW 6 48481103 missense possibly damaging 0.77
R3838:Sspo UTSW 6 48480820 missense probably damaging 1.00
R3850:Sspo UTSW 6 48492490 missense probably damaging 1.00
R3880:Sspo UTSW 6 48494940 missense probably benign 0.38
R3893:Sspo UTSW 6 48476571 nonsense probably null
R4116:Sspo UTSW 6 48456994 missense probably damaging 0.99
R4179:Sspo UTSW 6 48498395 critical splice donor site probably null
R4180:Sspo UTSW 6 48498395 critical splice donor site probably null
R4207:Sspo UTSW 6 48478293 missense probably benign 0.00
R4210:Sspo UTSW 6 48464901 missense probably benign 0.00
R4223:Sspo UTSW 6 48451157 missense possibly damaging 0.54
R4224:Sspo UTSW 6 48451157 missense possibly damaging 0.54
R4225:Sspo UTSW 6 48451157 missense possibly damaging 0.54
R4229:Sspo UTSW 6 48490934 missense probably benign 0.00
R4230:Sspo UTSW 6 48490934 missense probably benign 0.00
R4363:Sspo UTSW 6 48498731 missense probably damaging 1.00
R4370:Sspo UTSW 6 48466348 missense probably null 0.14
R4407:Sspo UTSW 6 48460520 missense probably damaging 1.00
R4438:Sspo UTSW 6 48487353 missense probably damaging 1.00
R4454:Sspo UTSW 6 48487225 missense probably benign 0.05
R4455:Sspo UTSW 6 48465516 missense probably damaging 1.00
R4561:Sspo UTSW 6 48475534 splice site probably null
R4574:Sspo UTSW 6 48465523 missense probably damaging 1.00
R4578:Sspo UTSW 6 48463373 missense possibly damaging 0.58
R4653:Sspo UTSW 6 48478646 missense probably damaging 1.00
R4656:Sspo UTSW 6 48454076 missense possibly damaging 0.65
R4659:Sspo UTSW 6 48484213 missense probably damaging 1.00
R4664:Sspo UTSW 6 48473534 missense possibly damaging 0.82
R4685:Sspo UTSW 6 48492894 missense probably damaging 0.98
R4692:Sspo UTSW 6 48482687 missense probably damaging 1.00
R4703:Sspo UTSW 6 48500453 missense probably damaging 1.00
R4704:Sspo UTSW 6 48498704 missense probably damaging 1.00
R4738:Sspo UTSW 6 48478396 missense possibly damaging 0.78
R4766:Sspo UTSW 6 48470580 missense probably benign 0.04
R4771:Sspo UTSW 6 48460879 missense probably damaging 1.00
R4790:Sspo UTSW 6 48460771 missense probably benign 0.04
R4792:Sspo UTSW 6 48461585 missense probably benign 0.00
R4808:Sspo UTSW 6 48451161 missense probably damaging 1.00
R4812:Sspo UTSW 6 48490510 missense probably benign 0.00
R4883:Sspo UTSW 6 48460822 missense probably benign 0.00
R4906:Sspo UTSW 6 48465730 critical splice acceptor site probably null
R4934:Sspo UTSW 6 48465552 missense probably damaging 1.00
R4945:Sspo UTSW 6 48467087 splice site probably null
R4967:Sspo UTSW 6 48464605 missense probably damaging 0.97
R5016:Sspo UTSW 6 48452280 nonsense probably null
R5018:Sspo UTSW 6 48455700 missense probably damaging 1.00
R5034:Sspo UTSW 6 48480823 missense possibly damaging 0.93
R5044:Sspo UTSW 6 48466955 critical splice acceptor site probably null
R5055:Sspo UTSW 6 48464795 missense probably damaging 1.00
R5087:Sspo UTSW 6 48488471 missense possibly damaging 0.51
R5155:Sspo UTSW 6 48460474 missense probably benign 0.03
R5223:Sspo UTSW 6 48478324 missense probably damaging 1.00
R5249:Sspo UTSW 6 48493310 missense probably damaging 0.98
R5257:Sspo UTSW 6 48476494 missense probably damaging 1.00
R5258:Sspo UTSW 6 48476494 missense probably damaging 1.00
R5276:Sspo UTSW 6 48490467 missense probably damaging 1.00
R5307:Sspo UTSW 6 48454850 missense probably damaging 0.99
R5341:Sspo UTSW 6 48459615 missense probably damaging 1.00
R5361:Sspo UTSW 6 48466313 missense probably benign 0.02
R5385:Sspo UTSW 6 48462253 missense probably benign 0.18
R5394:Sspo UTSW 6 48495260 missense possibly damaging 0.52
R5477:Sspo UTSW 6 48498393 missense possibly damaging 0.60
R5490:Sspo UTSW 6 48493280 missense probably benign 0.33
R5512:Sspo UTSW 6 48455671 missense probably damaging 0.97
R5518:Sspo UTSW 6 48496654 missense possibly damaging 0.92
R5530:Sspo UTSW 6 48465583 missense probably damaging 0.97
R5538:Sspo UTSW 6 48452178 missense probably damaging 0.99
R5590:Sspo UTSW 6 48474491 missense probably damaging 1.00
R5613:Sspo UTSW 6 48455044 missense possibly damaging 0.79
R5638:Sspo UTSW 6 48492891 missense possibly damaging 0.86
R5809:Sspo UTSW 6 48460045 missense possibly damaging 0.59
R5810:Sspo UTSW 6 48483898 missense probably benign 0.02
R5814:Sspo UTSW 6 48451884 missense probably damaging 1.00
R5915:Sspo UTSW 6 48464596 missense probably benign 0.00
R5915:Sspo UTSW 6 48491484 missense possibly damaging 0.83
R5979:Sspo UTSW 6 48463693 missense probably benign 0.20
R5996:Sspo UTSW 6 48494176 missense possibly damaging 0.87
R6012:Sspo UTSW 6 48451371 missense probably benign 0.00
R6025:Sspo UTSW 6 48486786 missense possibly damaging 0.83
R6120:Sspo UTSW 6 48465576 missense probably damaging 1.00
R6150:Sspo UTSW 6 48486379 missense probably benign 0.33
R6221:Sspo UTSW 6 48463705 missense probably damaging 1.00
R6261:Sspo UTSW 6 48462191 missense possibly damaging 0.75
R6312:Sspo UTSW 6 48457366 critical splice donor site probably null
R6372:Sspo UTSW 6 48472541 missense probably damaging 1.00
R6456:Sspo UTSW 6 48451806 missense probably benign 0.08
R6497:Sspo UTSW 6 48495208 missense possibly damaging 0.71
R6501:Sspo UTSW 6 48495212 missense possibly damaging 0.58
R6617:Sspo UTSW 6 48491046 missense possibly damaging 0.93
R6825:Sspo UTSW 6 48465525 missense probably benign 0.04
R6831:Sspo UTSW 6 48484833 missense possibly damaging 0.68
R6861:Sspo UTSW 6 48487955 missense probably benign 0.15
R6961:Sspo UTSW 6 48463877 missense probably benign 0.05
R6967:Sspo UTSW 6 48489794 missense probably benign 0.21
R7016:Sspo UTSW 6 48449164 missense probably damaging 1.00
R7035:Sspo UTSW 6 48449213 splice site probably null
R7058:Sspo UTSW 6 48448582 missense probably damaging 1.00
R7072:Sspo UTSW 6 48454979 missense probably damaging 1.00
R7078:Sspo UTSW 6 48460379 missense probably damaging 1.00
R7082:Sspo UTSW 6 48478609 critical splice acceptor site probably null
R7120:Sspo UTSW 6 48465571 missense probably benign 0.05
R7127:Sspo UTSW 6 48449512 missense probably benign 0.02
R7146:Sspo UTSW 6 48501095 missense probably benign 0.15
R7220:Sspo UTSW 6 48476606 nonsense probably null
R7242:Sspo UTSW 6 48473952 missense probably benign
R7261:Sspo UTSW 6 48450077 missense possibly damaging 0.52
R7313:Sspo UTSW 6 48454828 missense probably damaging 1.00
R7313:Sspo UTSW 6 48473456 missense probably benign 0.04
R7323:Sspo UTSW 6 48461647 missense possibly damaging 0.93
R7330:Sspo UTSW 6 48475462 missense probably benign 0.00
R7351:Sspo UTSW 6 48464921 missense possibly damaging 0.89
R7467:Sspo UTSW 6 48486303 missense probably damaging 1.00
R7475:Sspo UTSW 6 48455860 missense probably benign 0.37
R7489:Sspo UTSW 6 48473713 missense probably damaging 0.99
R7508:Sspo UTSW 6 48466699 missense probably damaging 1.00
R7515:Sspo UTSW 6 48493886 missense probably damaging 1.00
R7564:Sspo UTSW 6 48449500 missense probably benign 0.04
R7607:Sspo UTSW 6 48489727 missense probably damaging 1.00
R7620:Sspo UTSW 6 48467086 critical splice donor site probably null
R7667:Sspo UTSW 6 48475371 nonsense probably null
R7691:Sspo UTSW 6 48484229 missense probably benign 0.12
R7707:Sspo UTSW 6 48461527 missense probably benign 0.01
R7723:Sspo UTSW 6 48464638 missense probably damaging 0.99
R7748:Sspo UTSW 6 48449465 nonsense probably null
R7767:Sspo UTSW 6 48451382 missense probably damaging 0.96
R7792:Sspo UTSW 6 48454690 missense probably damaging 0.98
R7878:Sspo UTSW 6 48492526 missense probably damaging 1.00
R7893:Sspo UTSW 6 48463310 missense probably benign 0.02
R7942:Sspo UTSW 6 48488500 splice site probably null
R7952:Sspo UTSW 6 48487329 missense probably damaging 1.00
R7981:Sspo UTSW 6 48468494 missense probably benign
R7995:Sspo UTSW 6 48492889 missense probably damaging 1.00
R8088:Sspo UTSW 6 48457613 missense probably damaging 1.00
R8129:Sspo UTSW 6 48467025 missense possibly damaging 0.79
R8145:Sspo UTSW 6 48467749 missense possibly damaging 0.49
R8202:Sspo UTSW 6 48457600 missense probably damaging 1.00
R8211:Sspo UTSW 6 48492609 critical splice donor site probably null
R8240:Sspo UTSW 6 48483502 missense possibly damaging 0.84
R8252:Sspo UTSW 6 48485452 missense probably damaging 0.99
R8270:Sspo UTSW 6 48449963 missense probably benign
R8272:Sspo UTSW 6 48448519 missense probably benign 0.03
R8316:Sspo UTSW 6 48482688 missense probably damaging 1.00
R8384:Sspo UTSW 6 48482664 missense probably damaging 1.00
R8390:Sspo UTSW 6 48467962 missense probably benign 0.00
R8770:Sspo UTSW 6 48474272 missense probably null 1.00
R8827:Sspo UTSW 6 48457672 missense possibly damaging 0.59
R8882:Sspo UTSW 6 48475456 missense probably damaging 1.00
R8886:Sspo UTSW 6 48481267 missense possibly damaging 0.92
R8946:Sspo UTSW 6 48457137 missense probably damaging 1.00
R8947:Sspo UTSW 6 48448570 missense probably damaging 1.00
R9028:Sspo UTSW 6 48496153 missense probably benign 0.38
R9043:Sspo UTSW 6 48493280 missense probably benign 0.07
R9056:Sspo UTSW 6 48473674 missense probably damaging 0.97
R9071:Sspo UTSW 6 48457048 missense probably benign 0.00
R9133:Sspo UTSW 6 48457813 missense possibly damaging 0.81
R9187:Sspo UTSW 6 48495289 missense probably damaging 1.00
R9205:Sspo UTSW 6 48455872 missense probably benign 0.03
R9213:Sspo UTSW 6 48463935 missense possibly damaging 0.91
R9214:Sspo UTSW 6 48463935 missense possibly damaging 0.91
R9215:Sspo UTSW 6 48463935 missense possibly damaging 0.91
R9235:Sspo UTSW 6 48489784 missense probably damaging 1.00
R9254:Sspo UTSW 6 48487994 missense probably damaging 1.00
R9291:Sspo UTSW 6 48496396 missense probably damaging 1.00
R9312:Sspo UTSW 6 48468462 missense probably benign 0.00
R9357:Sspo UTSW 6 48467055 missense possibly damaging 0.77
RF009:Sspo UTSW 6 48459985 nonsense probably null
X0060:Sspo UTSW 6 48466294 missense probably damaging 1.00
X0060:Sspo UTSW 6 48480794 missense probably damaging 1.00
X0063:Sspo UTSW 6 48497422 missense probably damaging 0.96
X0065:Sspo UTSW 6 48461684 missense probably benign 0.00
Z1176:Sspo UTSW 6 48481293 missense probably damaging 1.00
Z1177:Sspo UTSW 6 48457026 missense probably benign 0.31
Z1177:Sspo UTSW 6 48464816 missense possibly damaging 0.72
Z1177:Sspo UTSW 6 48470984 missense probably benign 0.16
Z1177:Sspo UTSW 6 48473435 missense probably damaging 0.99
Z1177:Sspo UTSW 6 48490548 nonsense probably null
Z1177:Sspo UTSW 6 48490890 missense probably damaging 1.00
Z1186:Sspo UTSW 6 48468507 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gttcttaaccactgaccaatcc -3'
Posted On 2015-02-04