Mutagenetix > Incidental Mutation

Incidental Mutation 'ANU74:Vmn2r78'

262705

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r78

Ensembl Gene

ENSMUSG00000091962

Gene Name

vomeronasal 2, receptor 78

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

ANU74

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86915300-86955177 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 86921065 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 264 (V264L)

Ref Sequence

ENSEMBL: ENSMUSP00000126698 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170835]

AlphaFold

K7N6U5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170835
AA Change: V264L

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962
AA Change: V264L

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	75	464	5.9e-31	PFAM
Pfam:NCD3G	507	559	8.1e-21	PFAM
Pfam:7tm_3	592	827	1e-52	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 95.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgra3	G	A	5: 49,961,038	S1056L	probably benign	Het
Ankrd26	A	T	6: 118,552,775	D236E	probably benign	Het
Capn15	C	T	17: 25,965,486	W7*	probably null	Het
Celsr2	G	A	3: 108,412,499	T999M	probably damaging	Het
Chrd	T	A	16: 20,741,319	M912K	possibly damaging	Het
Col9a1	A	G	1: 24,185,328	D197G	unknown	Het
Csf1r	A	G	18: 61,117,391	E431G	probably benign	Het
Eloc	A	G	1: 16,643,350	F115L	possibly damaging	Het
Fap	T	C	2: 62,547,769	D193G	probably damaging	Het
Fscn2	T	C	11: 120,362,336	Y210H	probably damaging	Het
Fut9	G	C	4: 25,620,802	T4R	probably benign	Het
Grb2	A	T	11: 115,645,907	D131E	probably benign	Het
Hecw2	T	C	1: 53,925,694	T658A	probably benign	Het
Helz2	T	C	2: 181,234,834	E1289G	probably benign	Het
Hyou1	A	G	9: 44,381,263	N92D	possibly damaging	Het
Irf8	A	C	8: 120,739,869	I18L	possibly damaging	Het
Kif12	GGGGC	GGGGCCTCCACCCGGCGGGC	4: 63,171,423		probably benign	Het
Kif12	GC	"GCCTCCACCCGGCGGTC,GCC"	4: 63,171,426		probably null	Het
Lamc2	A	C	1: 153,131,835	D864E	probably benign	Het
Map3k4	A	G	17: 12,232,976	V1475A	probably damaging	Het
Mapk8ip3	A	C	17: 24,900,577	M1030R	possibly damaging	Het
Mat1a	A	G	14: 41,111,142	D94G	probably benign	Het
Myh15	T	A	16: 49,172,932	D1643E	possibly damaging	Het
Myo15b	T	C	11: 115,878,413	F55L	probably damaging	Het
Nhlh2	A	T	3: 102,012,654	M1L	probably benign	Het
Nup214	T	C	2: 32,034,966	S1836P	probably damaging	Het
Olfr1034	T	A	2: 86,047,311	Y276*	probably null	Het
Olr1	G	A	6: 129,500,069	R78C	possibly damaging	Het
Pam16	C	A	16: 4,616,633	V98F	probably damaging	Het
Pelp1	C	T	11: 70,395,087	V652I	probably damaging	Het
Pole	A	G	5: 110,289,370	H67R	probably benign	Het
Rbms1	G	T	2: 60,797,716	A60E	probably damaging	Het
Recql4	A	T	15: 76,705,757	M789K	possibly damaging	Het
Rrn3	T	C	16: 13,811,533	F571S	possibly damaging	Het
Ryr3	T	C	2: 112,831,230		probably null	Het
Sec61b	C	A	4: 47,474,922	N26K	possibly damaging	Het
Serinc1	T	C	10: 57,519,842	E284G	probably benign	Het
Slc30a9	G	A	5: 67,349,852	D496N	probably damaging	Het
Slc44a4	G	A	17: 34,921,578	R249H	probably damaging	Het
Slc6a13	A	C	6: 121,334,876	D404A	probably benign	Het
Spata18	A	G	5: 73,671,113	E225G	probably damaging	Het
Sspo	G	A	6: 48,460,959	G1351S	probably damaging	Het
Tgm3	T	C	2: 130,048,390	V691A	probably damaging	Het
Tns3	C	T	11: 8,492,149	R738Q	probably benign	Het
Tyk2	A	T	9: 21,116,158	I506N	probably damaging	Het
Ube2v1	G	A	2: 167,610,344	T113I	probably damaging	Het
Vmn1r177	A	G	7: 23,866,220	V77A	possibly damaging	Het
Vmn2r14	A	T	5: 109,219,044	S437T	probably benign	Het
Zfp956	T	G	6: 47,963,573	Y289D	probably benign	Het

Other mutations in Vmn2r78

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01302:Vmn2r78	APN	7	86915361	missense	unknown
IGL01473:Vmn2r78	APN	7	86920312	missense	possibly damaging	0.61
IGL01767:Vmn2r78	APN	7	86954435	missense	probably benign	0.28
IGL02322:Vmn2r78	APN	7	86921479	missense	probably damaging	0.96
IGL02537:Vmn2r78	APN	7	86954288	missense	probably damaging	0.99
IGL03297:Vmn2r78	APN	7	86920761	nonsense	probably null
R0035:Vmn2r78	UTSW	7	86920205	missense	probably benign	0.22
R0081:Vmn2r78	UTSW	7	86923027	missense	probably benign	0.35
R0401:Vmn2r78	UTSW	7	86921311	missense	probably benign	0.04
R0751:Vmn2r78	UTSW	7	86954380	missense	possibly damaging	0.77
R1341:Vmn2r78	UTSW	7	86922269	missense	possibly damaging	0.71
R1386:Vmn2r78	UTSW	7	86915407	missense	unknown
R1526:Vmn2r78	UTSW	7	86922257	splice site	probably null
R1712:Vmn2r78	UTSW	7	86954924	missense	probably damaging	1.00
R1739:Vmn2r78	UTSW	7	86920789	missense	probably benign
R1812:Vmn2r78	UTSW	7	86920787	missense	probably benign	0.38
R2011:Vmn2r78	UTSW	7	86955079	missense	possibly damaging	0.52
R2144:Vmn2r78	UTSW	7	86954482	missense	probably damaging	1.00
R2197:Vmn2r78	UTSW	7	86921327	missense	probably damaging	0.96
R2291:Vmn2r78	UTSW	7	86920154	missense	probably damaging	1.00
R2409:Vmn2r78	UTSW	7	86920745	splice site	probably benign
R3023:Vmn2r78	UTSW	7	86954966	missense	probably damaging	1.00
R4486:Vmn2r78	UTSW	7	86920751	critical splice acceptor site	probably null
R4512:Vmn2r78	UTSW	7	86920244	missense	probably benign	0.00
R4515:Vmn2r78	UTSW	7	86954258	missense	probably damaging	0.99
R4544:Vmn2r78	UTSW	7	86921191	missense	probably benign
R4546:Vmn2r78	UTSW	7	86954603	missense	probably damaging	1.00
R4872:Vmn2r78	UTSW	7	86954708	missense	possibly damaging	0.87
R4928:Vmn2r78	UTSW	7	86954627	missense	probably damaging	1.00
R5101:Vmn2r78	UTSW	7	86922355	missense	probably damaging	1.00
R5265:Vmn2r78	UTSW	7	86920124	missense	probably damaging	1.00
R5328:Vmn2r78	UTSW	7	86921030	missense	probably damaging	0.98
R5442:Vmn2r78	UTSW	7	86920122	missense	possibly damaging	0.95
R5567:Vmn2r78	UTSW	7	86921529	missense	probably benign	0.17
R5572:Vmn2r78	UTSW	7	86915512	missense	probably benign	0.01
R5636:Vmn2r78	UTSW	7	86954429	missense	probably damaging	0.99
R5901:Vmn2r78	UTSW	7	86954588	missense	probably damaging	1.00
R5977:Vmn2r78	UTSW	7	86920333	missense	possibly damaging	0.74
R5977:Vmn2r78	UTSW	7	86954907	missense	probably benign	0.00
R6276:Vmn2r78	UTSW	7	86921110	missense	probably benign	0.00
R6386:Vmn2r78	UTSW	7	86922337	nonsense	probably null
R6724:Vmn2r78	UTSW	7	86954258	missense	probably damaging	0.99
R6852:Vmn2r78	UTSW	7	86954603	missense	probably damaging	1.00
R6896:Vmn2r78	UTSW	7	86922350	missense	probably benign	0.10
R7385:Vmn2r78	UTSW	7	86922425	missense	probably benign	0.18
R7578:Vmn2r78	UTSW	7	86954344	nonsense	probably null
R7680:Vmn2r78	UTSW	7	86954941	missense	probably damaging	1.00
R7748:Vmn2r78	UTSW	7	86921135	missense	probably benign	0.00
R7852:Vmn2r78	UTSW	7	86920170	nonsense	probably null
R8031:Vmn2r78	UTSW	7	86954867	missense	probably damaging	1.00
R8070:Vmn2r78	UTSW	7	86922487	missense	probably benign	0.01
R8085:Vmn2r78	UTSW	7	86954790	missense	probably benign	0.00
R8163:Vmn2r78	UTSW	7	86954452	missense	probably damaging	1.00
R8501:Vmn2r78	UTSW	7	86920886	missense	probably damaging	0.99
R8749:Vmn2r78	UTSW	7	86954305	missense	possibly damaging	0.81
R9209:Vmn2r78	UTSW	7	86920223	missense	probably benign	0.08
RF018:Vmn2r78	UTSW	7	86954431	nonsense	probably null
Z1177:Vmn2r78	UTSW	7	86921207	missense	probably benign	0.44
Z1177:Vmn2r78	UTSW	7	86954774	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GTCCCTAGCCGTTCACTTCAGATG -3'
(R):5'- TGGGCCACAGCATACACAGAATTG -3'

Sequencing Primer
(F):5'- CGTTCACTTCAGATGGAACTG -3'
(R):5'- CACTCATAGACATTCCAAGAGGTGG -3'

Posted On

2015-02-04