Incidental Mutation 'ANU74:Irf8'
ID262707
Institutional Source Beutler Lab
Gene Symbol Irf8
Ensembl Gene ENSMUSG00000041515
Gene Nameinterferon regulatory factor 8
SynonymsIcsbp1, ICSBP, Myls, IRF-8
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #ANU74
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location120736358-120756694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 120739869 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 18 (I18L)
Ref Sequence ENSEMBL: ENSMUSP00000125443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047737] [ENSMUST00000127664] [ENSMUST00000160943] [ENSMUST00000162001] [ENSMUST00000162658]
Predicted Effect probably benign
Transcript: ENSMUST00000047737
AA Change: I18L

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000040245
Gene: ENSMUSG00000041515
AA Change: I18L

DomainStartEndE-ValueType
IRF 3 115 8.69e-65 SMART
Blast:IRF 129 176 7e-11 BLAST
IRF-3 202 380 2.63e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160943
AA Change: I18L
SMART Domains Protein: ENSMUSP00000125447
Gene: ENSMUSG00000041515
AA Change: I18L

DomainStartEndE-ValueType
IRF 3 85 2.54e-16 SMART
IRF-3 111 289 2.63e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162001
AA Change: I18L

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125029
Gene: ENSMUSG00000041515
AA Change: I18L

DomainStartEndE-ValueType
IRF 3 115 8.69e-65 SMART
Blast:IRF 129 176 7e-11 BLAST
IRF-3 202 380 2.63e-78 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162658
AA Change: I18L

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125443
Gene: ENSMUSG00000041515
AA Change: I18L

DomainStartEndE-ValueType
IRF 3 85 2.54e-16 SMART
Pfam:IRF-3 111 151 4.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162775
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a transcription factor that belongs to the interferon regulatory factor family. Proteins belonging to this family have a DNA binding domain at the amino terminus that contains five well-conserved tryptophan-rich repeats. This domain recognizes DNA sequences similar to the interferon-stimulated response element. The protein encoded by this gene promotes or suppresses lineage-specific genes to regulate the differentation of lymphoid and myeloid lineage cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased incidence of viral infections, shortened life span, deregulated hematopoiesis, and hematological neoplasias. Heterozygotes show similar, but milder, phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 G A 5: 49,961,038 S1056L probably benign Het
Ankrd26 A T 6: 118,552,775 D236E probably benign Het
Capn15 C T 17: 25,965,486 W7* probably null Het
Celsr2 G A 3: 108,412,499 T999M probably damaging Het
Chrd T A 16: 20,741,319 M912K possibly damaging Het
Col9a1 A G 1: 24,185,328 D197G unknown Het
Csf1r A G 18: 61,117,391 E431G probably benign Het
Eloc A G 1: 16,643,350 F115L possibly damaging Het
Fap T C 2: 62,547,769 D193G probably damaging Het
Fscn2 T C 11: 120,362,336 Y210H probably damaging Het
Fut9 G C 4: 25,620,802 T4R probably benign Het
Grb2 A T 11: 115,645,907 D131E probably benign Het
Hecw2 T C 1: 53,925,694 T658A probably benign Het
Helz2 T C 2: 181,234,834 E1289G probably benign Het
Hyou1 A G 9: 44,381,263 N92D possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kif12 GC "GCCTCCACCCGGCGGTC,GCC" 4: 63,171,426 probably null Het
Lamc2 A C 1: 153,131,835 D864E probably benign Het
Map3k4 A G 17: 12,232,976 V1475A probably damaging Het
Mapk8ip3 A C 17: 24,900,577 M1030R possibly damaging Het
Mat1a A G 14: 41,111,142 D94G probably benign Het
Myh15 T A 16: 49,172,932 D1643E possibly damaging Het
Myo15b T C 11: 115,878,413 F55L probably damaging Het
Nhlh2 A T 3: 102,012,654 M1L probably benign Het
Nup214 T C 2: 32,034,966 S1836P probably damaging Het
Olfr1034 T A 2: 86,047,311 Y276* probably null Het
Olr1 G A 6: 129,500,069 R78C possibly damaging Het
Pam16 C A 16: 4,616,633 V98F probably damaging Het
Pelp1 C T 11: 70,395,087 V652I probably damaging Het
Pole A G 5: 110,289,370 H67R probably benign Het
Rbms1 G T 2: 60,797,716 A60E probably damaging Het
Recql4 A T 15: 76,705,757 M789K possibly damaging Het
Rrn3 T C 16: 13,811,533 F571S possibly damaging Het
Ryr3 T C 2: 112,831,230 probably null Het
Sec61b C A 4: 47,474,922 N26K possibly damaging Het
Serinc1 T C 10: 57,519,842 E284G probably benign Het
Slc30a9 G A 5: 67,349,852 D496N probably damaging Het
Slc44a4 G A 17: 34,921,578 R249H probably damaging Het
Slc6a13 A C 6: 121,334,876 D404A probably benign Het
Spata18 A G 5: 73,671,113 E225G probably damaging Het
Sspo G A 6: 48,460,959 G1351S probably damaging Het
Tgm3 T C 2: 130,048,390 V691A probably damaging Het
Tns3 C T 11: 8,492,149 R738Q probably benign Het
Tyk2 A T 9: 21,116,158 I506N probably damaging Het
Ube2v1 G A 2: 167,610,344 T113I probably damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn2r14 A T 5: 109,219,044 S437T probably benign Het
Vmn2r78 G C 7: 86,921,065 V264L possibly damaging Het
Zfp956 T G 6: 47,963,573 Y289D probably benign Het
Other mutations in Irf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Irf8 APN 8 120753380 missense probably damaging 1.00
IGL02944:Irf8 APN 8 120755125 missense probably benign 0.00
IGL03024:Irf8 APN 8 120753358 missense probably damaging 0.98
gemini UTSW 8 120743883 nonsense probably null
gemini2 UTSW 8 120753707 missense probably damaging 0.97
glenn UTSW 8 120739842 missense probably damaging 1.00
R0211:Irf8 UTSW 8 120739975 missense probably damaging 1.00
R0211:Irf8 UTSW 8 120739975 missense probably damaging 1.00
R0840:Irf8 UTSW 8 120753481 missense probably benign 0.06
R1622:Irf8 UTSW 8 120739822 missense possibly damaging 0.86
R1715:Irf8 UTSW 8 120754388 missense probably damaging 0.98
R2274:Irf8 UTSW 8 120753527 missense probably damaging 0.99
R2875:Irf8 UTSW 8 120754463 missense probably damaging 1.00
R3743:Irf8 UTSW 8 120753571 missense probably damaging 1.00
R4209:Irf8 UTSW 8 120753469 missense probably damaging 0.99
R4729:Irf8 UTSW 8 120753439 missense probably damaging 0.99
R6343:Irf8 UTSW 8 120753707 missense probably damaging 0.97
R6950:Irf8 UTSW 8 120755125 missense probably benign 0.00
R7051:Irf8 UTSW 8 120739842 missense probably damaging 1.00
R7052:Irf8 UTSW 8 120739842 missense probably damaging 1.00
R7249:Irf8 UTSW 8 120739832 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGCACTGCTGATTTCTCATGGCAC -3'
(R):5'- GGCAGGAAAGTCACTCTCAACCTC -3'

Sequencing Primer
(F):5'- TCATGGCACTGGTCCAGATG -3'
(R):5'- ATACCTCCAGAGCCAGAGGG -3'
Posted On2015-02-04